ID: 907009544

View in Genome Browser
Species Human (GRCh38)
Location 1:50950770-50950792
Sequence TAGTAGATCTTCAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907009544 Original CRISPR TAGTAGATCTTCAGGAAGGA AGG (reversed) Intronic
902045599 1:13521674-13521696 GAGGAGATCATGAGGAAGGAGGG - Intergenic
902489009 1:16766898-16766920 TAGGAGGTCCTCAGGGAGGAGGG - Intronic
903589652 1:24444979-24445001 TAGGAAATCCTCAGGAAGGAAGG + Intronic
906222129 1:44089076-44089098 TGTTAAATCTTCAAGAAGGAGGG + Intergenic
906945659 1:50292176-50292198 TAGTTAATCTTCTGGATGGAGGG + Intergenic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
909332040 1:74425130-74425152 GAGTAGAGCTTCAGGCAGAAGGG + Intronic
911597746 1:99816144-99816166 TAGTACATCTAAAGGAAGAAAGG - Intergenic
913978879 1:143489556-143489578 TGGGAGATCTTTAGGAATGAGGG + Intergenic
914073284 1:144315205-144315227 TAAGAGATCTTTAGGAATGAGGG + Intergenic
914105870 1:144651155-144651177 TAAGAGATCTTTAGGAATGAGGG - Intergenic
914892181 1:151635587-151635609 TCTTAATTCTTCAGGAAGGAGGG + Intronic
915593195 1:156882104-156882126 TAGTTCATGTTCAGGAAGGCTGG + Intergenic
916258553 1:162816712-162816734 TAGTTGTTCTTCAGGAAGGATGG + Intergenic
917179548 1:172280438-172280460 TGGTAGTTATTCAGGAATGAAGG + Intronic
917675040 1:177310796-177310818 AAGTAGATATTAGGGAAGGAAGG - Intergenic
920742688 1:208596464-208596486 TAGGTGATCTGCAGGAAGGAAGG + Intergenic
920943311 1:210504651-210504673 CATCAGATCATCAGGAAGGAGGG - Intronic
921535748 1:216346698-216346720 AACTAGATCTTCAGGAATTAAGG - Intronic
923531427 1:234815626-234815648 TAGGAGGTCCTCAGGGAGGAGGG + Intergenic
923849125 1:237773917-237773939 TAGTAAATATTAAGGAAGGAAGG + Intronic
924258422 1:242205129-242205151 TAGAACATATTCAGGAAGCAGGG + Intronic
924313419 1:242771045-242771067 TAGTAGATATTTTGGAAGCATGG - Intergenic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1065395571 10:25233210-25233232 TTATAGCTCTTCAGGAAAGAGGG + Intronic
1066560684 10:36666385-36666407 TATTAGATCTTAAGGCTGGATGG + Intergenic
1066724998 10:38382394-38382416 TAGTTGTTCTTCAGGAAGGATGG + Intergenic
1066996955 10:42572741-42572763 CAGTAGATCTTCAGGGATCAAGG + Intergenic
1067010906 10:42712875-42712897 TAGAAGCTCATCAGCAAGGAAGG + Intergenic
1073852171 10:107633938-107633960 TAGTAATTTTTCAGGCAGGAAGG + Intergenic
1074522336 10:114237092-114237114 TTGTAAATCTTCACAAAGGAAGG + Intergenic
1077698740 11:4419837-4419859 CAGTGGATCCTCAGGAAGGTAGG + Intergenic
1078031548 11:7757024-7757046 TAGTAAATATTCAGGTAGAAAGG + Intergenic
1078710313 11:13784714-13784736 TAGTATATCTCAAGGAGGGAAGG - Intergenic
1079714182 11:23723964-23723986 TAGTTGACATCCAGGAAGGAGGG - Intergenic
1081660743 11:44886694-44886716 TTACAGATCTTTAGGAAGGAAGG - Intronic
1083810074 11:65099243-65099265 AACTAGGTCCTCAGGAAGGAGGG + Intronic
1087252293 11:95916430-95916452 TATTATATCTTCAGGAGGAAGGG - Intronic
1088889004 11:114030203-114030225 TCCTAGCTCTTGAGGAAGGAGGG + Intergenic
1089272955 11:117314734-117314756 TTGGAGATTGTCAGGAAGGATGG + Intronic
1089996598 11:122913717-122913739 CAGGAGATGTTCAGGAATGAGGG - Intronic
1090040059 11:123282973-123282995 TTGTAGATTTGCAGGCAGGAAGG - Intergenic
1090541032 11:127705802-127705824 TATTATATTTTCAGGTAGGATGG + Intergenic
1090612125 11:128480547-128480569 AATCAGATCTGCAGGAAGGACGG + Intronic
1090761537 11:129841094-129841116 TACTAGATCTTCAGGCAAGTAGG + Intronic
1090971374 11:131646289-131646311 TAGTAGATCTTCAGGCTAGCAGG - Intronic
1092836372 12:12492910-12492932 AAGTAAATATTGAGGAAGGAAGG - Intronic
1092856053 12:12674814-12674836 TACTAGATCTTCATGAGGGTAGG - Intronic
1098022101 12:66167097-66167119 TAGAAGATCAGCAGGAAGGGAGG + Intronic
1098350015 12:69548866-69548888 TACTAGAACCTCAGTAAGGAAGG + Intronic
1098579236 12:72079343-72079365 AAGTAGACCTTCAGTGAGGAGGG - Intronic
1098627305 12:72688219-72688241 TTAGAGATCTTAAGGAAGGAAGG + Intergenic
1098716309 12:73831296-73831318 TAGTGGATCATTAGGAATGATGG - Intergenic
1098994607 12:77104516-77104538 GAGTGCATCTTCTGGAAGGATGG - Intergenic
1100274729 12:93061865-93061887 TAATGAATCCTCAGGAAGGATGG + Intergenic
1100356531 12:93836280-93836302 TGATAGAGCTTCAGGAAGGTAGG + Intronic
1100407293 12:94282819-94282841 TAGAACTTCTTCAGGAAGCAAGG - Intronic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1105220454 13:18321837-18321859 TGGGAGATCTTTAGGAATGAGGG - Intergenic
1105919551 13:24949275-24949297 TACTAGAAATACAGGAAGGAAGG - Intergenic
1105951309 13:25231639-25231661 TAGTAGCTGCACAGGAAGGAGGG + Intergenic
1106977517 13:35238304-35238326 TAGTTGATCTTCAGGCAGCCTGG + Intronic
1109557545 13:63999704-63999726 TAGTAGTTCCTTAGGATGGAGGG + Intergenic
1113833824 13:113315784-113315806 TTGAAGATACTCAGGAAGGAAGG - Intronic
1116171423 14:41407469-41407491 TTACAGATCCTCAGGAAGGAGGG + Intergenic
1118293894 14:64550660-64550682 CAGTAGAACGGCAGGAAGGAGGG - Intronic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1120739922 14:88096788-88096810 TAGTAGAACTTCAGGCCAGATGG - Intergenic
1202871365 14_GL000225v1_random:167779-167801 TGGGAGATCTTTAGGAATGAGGG + Intergenic
1124925446 15:34066050-34066072 TAGTAGAATCTCAGGCAGGACGG + Exonic
1125138553 15:36374490-36374512 TAGAAAATATTCTGGAAGGAGGG + Intergenic
1126492794 15:49258340-49258362 TAGTATATTTTAAGGAAGTAAGG + Intronic
1127527941 15:59812425-59812447 TAGTAGCTTTTCAGGCAGAAGGG + Intergenic
1128129447 15:65215890-65215912 TAGTATATATACAGGAAGCAGGG - Intergenic
1130017483 15:80199083-80199105 TAGTAGCATTTCAGGAAGGGTGG - Intergenic
1130769070 15:86906223-86906245 TAGAAAGTCTTCAGGAAAGAAGG + Intronic
1131460909 15:92616917-92616939 GAGTAGCTCCTCAGGGAGGAGGG + Intergenic
1131990395 15:98088016-98088038 TAGAAGAACTTCAGAAAGAAGGG + Intergenic
1133656247 16:7867441-7867463 TAGCTGATGTTCAGGAGGGAGGG - Intergenic
1137924299 16:52525289-52525311 TAGGAGAGCTTCAGGAAAAAAGG - Intronic
1140121016 16:72082956-72082978 GAGGAGATCTTCGGGAAGGAAGG - Intronic
1140162311 16:72510244-72510266 TAGTAATTATTCAGGAATGAGGG + Intergenic
1141681491 16:85546872-85546894 AGGTAGATCCTCAGGAAGGCTGG + Intergenic
1143912916 17:10266815-10266837 TATTGGCTCTTCAGGAAAGAGGG + Intergenic
1144309784 17:14002040-14002062 TAGAAGAGTTTCAGGAAAGACGG + Intergenic
1144312275 17:14024342-14024364 GAGTAGGTCTTATGGAAGGAAGG + Intergenic
1144332484 17:14236983-14237005 GAGTAGGTCTTATGGAAGGAAGG - Intergenic
1144498343 17:15764530-15764552 GAGTAGGTCTTATGGAAGGAAGG + Intergenic
1145925390 17:28643168-28643190 CAGAAGATCTTCAATAAGGATGG + Exonic
1153417941 18:4870401-4870423 GAGTAGATTGGCAGGAAGGATGG - Intergenic
1155804738 18:30154425-30154447 TAGAAAATCTTCAAGAAGGCGGG - Intergenic
1156242025 18:35264038-35264060 TTGCAGCTCCTCAGGAAGGATGG + Exonic
1156549033 18:37995580-37995602 GAATATATCTTCAGGAAGAAAGG - Intergenic
1158355443 18:56613515-56613537 TAGTCAATCTTCAGAAAGGCTGG + Intronic
1159034967 18:63267912-63267934 TATTATATTTTTAGGAAGGAAGG - Intronic
1159560516 18:69987774-69987796 AAGTAAATCTTCAGAAATGAAGG + Intergenic
1159625789 18:70692363-70692385 GAGTTCATCTTCAGGAATGAGGG - Intergenic
1160495566 18:79372387-79372409 TAACAGTTCTTCAGTAAGGATGG - Intronic
1164842845 19:31406405-31406427 TCTTTTATCTTCAGGAAGGATGG - Intergenic
1165763809 19:38337608-38337630 TAGTTGATCTTCAGGTAGTAAGG - Exonic
1167285226 19:48595481-48595503 TAGTAGACACTCAGAAAGGAAGG + Intronic
925047619 2:785993-786015 TGGGAGAGCTACAGGAAGGAAGG + Intergenic
926327882 2:11800672-11800694 TAGGAGATCTTAAGGGAGGCAGG + Intronic
928082280 2:28322032-28322054 TAATAGATCCTTAGGAAGGAAGG + Intronic
928748427 2:34442964-34442986 GAGCACCTCTTCAGGAAGGAGGG - Intergenic
929093849 2:38245597-38245619 CTGTACATCCTCAGGAAGGAAGG + Intergenic
930454411 2:51587334-51587356 TGCTAGACCTTCAGGAAGTAAGG - Intergenic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
933044002 2:77510328-77510350 TAATGTGTCTTCAGGAAGGAGGG + Intronic
934293887 2:91724808-91724830 TGGGAGATCTTTAGGAATGAGGG + Intergenic
938382143 2:130842750-130842772 TAAGAGATCTGCAGGAAGGTGGG - Intronic
940833887 2:158499028-158499050 TAGAATATGTTCAGGAAGAACGG + Intronic
941447760 2:165623762-165623784 AAGTAGGAATTCAGGAAGGAGGG - Intronic
941550134 2:166904964-166904986 TACTTGATTTTCAAGAAGGATGG - Intronic
943104506 2:183527908-183527930 GAGAAGATCATCAAGAAGGAAGG + Intergenic
943778311 2:191792638-191792660 AAGTACATCTTCAGGAAAGAGGG - Intergenic
946438073 2:219672335-219672357 AAGTTGATCTTCAGGAAGCTAGG + Intergenic
948123772 2:235550047-235550069 TTGTACATTTTTAGGAAGGACGG + Intronic
948253131 2:236546599-236546621 GAGTAAAGCTTCAGGCAGGAGGG - Intergenic
948291992 2:236832411-236832433 TGGTACATGTGCAGGAAGGAGGG + Intergenic
948813021 2:240494680-240494702 TGGAAGAGCTCCAGGAAGGAAGG - Intronic
1168989997 20:2086966-2086988 TGGTGGAGCATCAGGAAGGAAGG - Intergenic
1170646260 20:18198642-18198664 TAGAAGGTCTTGAGGAAGCAAGG + Intergenic
1170809486 20:19662469-19662491 TATTAAATCTCCTGGAAGGAAGG - Intronic
1174755198 20:53151511-53151533 GATAATATCTTCAGGAAGGAAGG + Intronic
1175647869 20:60691113-60691135 AATCAGAGCTTCAGGAAGGAAGG + Intergenic
1177410663 21:20726434-20726456 AAATACATCTTCAGGGAGGAAGG + Intergenic
1178178124 21:30128506-30128528 GAGTAGACATTCAGGAAGAAAGG - Intergenic
1178708338 21:34891428-34891450 TTTTAGATCCTCAGTAAGGAAGG - Intronic
1179164410 21:38924579-38924601 CAGTGGATCTGCAGGAAGGCTGG - Intergenic
1181412177 22:22731635-22731657 GAGTAGGTCTTATGGAAGGAAGG - Intergenic
1181675778 22:24450738-24450760 TAATAGCTCTGGAGGAAGGAAGG + Intergenic
1183928834 22:41224751-41224773 CAGTAGATCTTCCGGAAGGTGGG - Exonic
1184422622 22:44390695-44390717 GATTGGATCTTCAAGAAGGATGG + Intergenic
949752158 3:7366131-7366153 TTTTAGATCTACAGGAAGTAAGG - Intronic
950573882 3:13819227-13819249 TTCTTGATCTTCAGGAAGGTGGG + Exonic
953414341 3:42707068-42707090 GAGGTGATCTTGAGGAAGGATGG + Intronic
955112526 3:55963055-55963077 CAGAAGAGCTTCAGGATGGAAGG + Intronic
955644077 3:61118046-61118068 GATTCTATCTTCAGGAAGGAGGG + Intronic
955973958 3:64463089-64463111 AATTGGATCTTTAGGAAGGAGGG + Intergenic
956796659 3:72724198-72724220 TAGTTGTTCTTAAGTAAGGATGG - Intergenic
957223343 3:77412455-77412477 CAGTAGATCTTGAGGACAGAGGG - Intronic
957851374 3:85811906-85811928 TAGTAGCTTTTAAGGAAGGCAGG + Intronic
958596991 3:96239179-96239201 TAGTAGATCATTAGGAGTGATGG + Intergenic
958673551 3:97235592-97235614 TGGAAGATATTTAGGAAGGATGG - Intronic
960594640 3:119397171-119397193 TAGTTAATCTCCAGAAAGGAGGG + Intronic
960926893 3:122803310-122803332 GAGAAGAGCTTCAGGAAGGTAGG + Intronic
962416079 3:135183283-135183305 TACCAGCTCTCCAGGAAGGAAGG - Intronic
962936617 3:140087215-140087237 TTGCTGAACTTCAGGAAGGAGGG + Intronic
962936806 3:140089084-140089106 TAGCAGGTCTTCAGGAAAGAGGG - Intronic
965969817 3:174541017-174541039 TATTAGATCTACTGGAAGTAAGG + Intronic
965977037 3:174638559-174638581 TAGGAGATGTTGAAGAAGGAGGG + Intronic
967138661 3:186533982-186534004 AAGTAGTTCTTCAGGACTGAGGG + Intergenic
967241944 3:187448096-187448118 TAGGAGATGTTCAGGCAGGCAGG - Intergenic
967251066 3:187539204-187539226 TAGTGGATCTTCAAAAAAGATGG - Intergenic
969128893 4:4975908-4975930 TCGTAGTTCTGCAGGAAGAATGG - Intergenic
972105724 4:35483634-35483656 TAGATGACTTTCAGGAAGGATGG - Intergenic
976597602 4:86908661-86908683 TAAATGATCTTCAGGAGGGAGGG - Intronic
986531110 5:8737986-8738008 AAGAAGAATTTCAGGAAGGAAGG + Intergenic
986816743 5:11420896-11420918 TGGTATATCTTGAGGAAGTAAGG + Intronic
987642199 5:20627259-20627281 TGATAGATCTTCAGTAATGAAGG - Intergenic
990735211 5:58853059-58853081 TAGTGGATCTTCAACTAGGAAGG - Exonic
992136079 5:73747442-73747464 TAGGAGATCAGCAGGAAGAACGG - Intronic
992650503 5:78855061-78855083 TAGTACAGCCCCAGGAAGGAAGG + Intronic
995433318 5:112106739-112106761 TAGAAGTTCTTGAGGCAGGATGG - Intergenic
995795327 5:115935350-115935372 TAGAAGAGATGCAGGAAGGAAGG + Intergenic
996085623 5:119301973-119301995 TAGTTTATCTTCAGGAATGAAGG + Intronic
998974787 5:147633604-147633626 TAGTATAACTTGAGGAAGCATGG + Intronic
1000252181 5:159506213-159506235 TAGTAGACCTGCAATAAGGAGGG - Intergenic
1001199342 5:169701837-169701859 CAGAGGATCTTCAGGAAGGGAGG - Intronic
1001535108 5:172492621-172492643 CAGTGGTTCTTCAGGAGGGAAGG - Intergenic
1002853355 6:1016184-1016206 TTATAGATCTTCAGGTGGGAGGG - Intergenic
1002871562 6:1171056-1171078 CAGTGGATTTTCAGGCAGGAAGG - Intergenic
1006079370 6:31556426-31556448 AAGTAGGTCCACAGGAAGGAAGG + Intronic
1006095784 6:31655952-31655974 TGGAACATCTTCAGGCAGGAGGG - Exonic
1008460089 6:51758539-51758561 TCCTAGATCTTCAGGGAAGAGGG + Intronic
1010892734 6:81334422-81334444 GAGTAGATCATCTGGAAAGAAGG + Intergenic
1010924393 6:81726015-81726037 AAGTAAATCTGCAAGAAGGATGG + Intronic
1011690878 6:89867591-89867613 TGCTAGATCTTCAAGAAGTATGG - Exonic
1014056383 6:117019975-117019997 CATTATATCTTCAGGAAGGAGGG + Intergenic
1014316001 6:119865437-119865459 TTGTAGAACCTCAGAAAGGAAGG + Intergenic
1015296714 6:131602991-131603013 TAATAAATCTTAAGGAAAGATGG + Intronic
1017072648 6:150589404-150589426 GAGTAGATGAACAGGAAGGAAGG + Intergenic
1017743909 6:157429896-157429918 TAGAGAATCTTCAGGAGGGAAGG + Intronic
1018153981 6:160968135-160968157 TAGTAGATCTTCAAGATTCAGGG - Intergenic
1019082206 6:169442505-169442527 TAGAAGATCTTAAGGAAATAAGG - Intergenic
1021272547 7:18608891-18608913 TAGTAGTTCCTCAAGAAGTACGG - Intronic
1022412849 7:30152682-30152704 TAGAAGGTCTTCATAAAGGAAGG - Intronic
1023977997 7:45046651-45046673 TAGAAAATCTTCAGGATGCAGGG + Intronic
1024877035 7:54037573-54037595 TAGTAGAGCTGTGGGAAGGAAGG - Intergenic
1026456870 7:70580394-70580416 TATTAGTTCTTCAGGAAGGAAGG + Intronic
1030615594 7:111734884-111734906 TAATAGAAGTTCAGGAAAGAGGG + Intronic
1030717774 7:112830550-112830572 ATGTATATCTTGAGGAAGGAAGG + Intronic
1033759792 7:144426244-144426266 TAGTAAGTTTTCAGGAAGAATGG - Intergenic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1036994821 8:13643367-13643389 CAGAAAGTCTTCAGGAAGGAGGG + Intergenic
1037750004 8:21675302-21675324 AAGTAGGTCATCAGGATGGACGG + Intergenic
1039506753 8:38057738-38057760 TAGTGGATCTTCATGAAGGCAGG + Intronic
1043134915 8:76509497-76509519 AAGTAGATATTAATGAAGGAAGG - Intergenic
1043914172 8:85901226-85901248 TAGGACATCATCAGGAAGAATGG - Intergenic
1045155938 8:99471190-99471212 AATTAGATCTTTAGGAATGAAGG + Intronic
1045379619 8:101610371-101610393 TAGTAATCCTACAGGAAGGAGGG + Intronic
1048327229 8:133449167-133449189 TAGTATATATTAAGGAAAGACGG - Intergenic
1056289719 9:85130499-85130521 TCTTACATCTTCAGAAAGGAAGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057495229 9:95555215-95555237 TAGGAGCTCTTCAGGTTGGATGG + Intergenic
1057611917 9:96552187-96552209 CAGTGGACTTTCAGGAAGGAGGG - Intronic
1057873106 9:98732861-98732883 TTCTAGATCGTCAGGGAGGAAGG - Exonic
1057873307 9:98734029-98734051 TTATAGATCGTCAGGGAGGAGGG - Exonic
1058565571 9:106281485-106281507 TGGTAGATCTCCATGAAGGAGGG - Intergenic
1059148351 9:111922509-111922531 TAGTAAATCTTCAGTAGTGATGG + Intronic
1061017245 9:127989003-127989025 TAGAAGAACCTCAGGAAGCAGGG - Intergenic
1061279030 9:129586566-129586588 TAGTAGGTGCTCAGGAAGGAAGG + Intergenic
1186104432 X:6191261-6191283 GGGTAGAACTTCAGTAAGGAGGG + Intronic
1189457852 X:41210219-41210241 TAGTACGGCTCCAGGAAGGATGG - Intronic
1190644206 X:52509861-52509883 CAGTAGATTTTCAGGTGGGAAGG - Intergenic
1191629821 X:63311101-63311123 TAGTAGATCACTAGGAATGATGG + Intergenic
1192659806 X:73030359-73030381 TAGCAGATCTTCAAGAGGGAAGG + Intergenic
1195577372 X:106467149-106467171 AAGTAGGTGGTCAGGAAGGAAGG - Intergenic
1198939790 X:141941020-141941042 TGGTAGCTCTTCAGGGAAGAGGG + Intergenic
1199038389 X:143080149-143080171 TAGTATTTCTTCAGAAGGGAAGG + Intergenic