ID: 907012645

View in Genome Browser
Species Human (GRCh38)
Location 1:50977970-50977992
Sequence GCGCCTCCAAGGTTACCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907012645_907012655 17 Left 907012645 1:50977970-50977992 CCCGCGGGTAACCTTGGAGGCGC No data
Right 907012655 1:50978010-50978032 GCGCGGCCGCGCGGCCGGCCGGG No data
907012645_907012652 8 Left 907012645 1:50977970-50977992 CCCGCGGGTAACCTTGGAGGCGC No data
Right 907012652 1:50978001-50978023 TGAGTGTGTGCGCGGCCGCGCGG No data
907012645_907012651 0 Left 907012645 1:50977970-50977992 CCCGCGGGTAACCTTGGAGGCGC No data
Right 907012651 1:50977993-50978015 CCTCGGAGTGAGTGTGTGCGCGG No data
907012645_907012653 12 Left 907012645 1:50977970-50977992 CCCGCGGGTAACCTTGGAGGCGC No data
Right 907012653 1:50978005-50978027 TGTGTGCGCGGCCGCGCGGCCGG No data
907012645_907012658 26 Left 907012645 1:50977970-50977992 CCCGCGGGTAACCTTGGAGGCGC No data
Right 907012658 1:50978019-50978041 CGCGGCCGGCCGGGGCGAGCAGG No data
907012645_907012654 16 Left 907012645 1:50977970-50977992 CCCGCGGGTAACCTTGGAGGCGC No data
Right 907012654 1:50978009-50978031 TGCGCGGCCGCGCGGCCGGCCGG No data
907012645_907012656 18 Left 907012645 1:50977970-50977992 CCCGCGGGTAACCTTGGAGGCGC No data
Right 907012656 1:50978011-50978033 CGCGGCCGCGCGGCCGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907012645 Original CRISPR GCGCCTCCAAGGTTACCCGC GGG (reversed) Intergenic
No off target data available for this crispr