ID: 907012917

View in Genome Browser
Species Human (GRCh38)
Location 1:50979734-50979756
Sequence CTGTCCACTGAGAAGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907012917_907012920 -10 Left 907012917 1:50979734-50979756 CCCTGTTCCTTCTCAGTGGACAG No data
Right 907012920 1:50979747-50979769 CAGTGGACAGTCTGCACAACTGG No data
907012917_907012921 -6 Left 907012917 1:50979734-50979756 CCCTGTTCCTTCTCAGTGGACAG No data
Right 907012921 1:50979751-50979773 GGACAGTCTGCACAACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907012917 Original CRISPR CTGTCCACTGAGAAGGAACA GGG (reversed) Intergenic
No off target data available for this crispr