ID: 907020330

View in Genome Browser
Species Human (GRCh38)
Location 1:51060500-51060522
Sequence TGCCTGCAGTGTGACGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907020330_907020335 11 Left 907020330 1:51060500-51060522 CCCCACTCGTCACACTGCAGGCA No data
Right 907020335 1:51060534-51060556 AGAAGAGCTGCAGCCCTTCAGGG No data
907020330_907020334 10 Left 907020330 1:51060500-51060522 CCCCACTCGTCACACTGCAGGCA No data
Right 907020334 1:51060533-51060555 GAGAAGAGCTGCAGCCCTTCAGG No data
907020330_907020338 27 Left 907020330 1:51060500-51060522 CCCCACTCGTCACACTGCAGGCA No data
Right 907020338 1:51060550-51060572 TTCAGGGAGCTCAGATGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907020330 Original CRISPR TGCCTGCAGTGTGACGAGTG GGG (reversed) Intergenic