ID: 907020332

View in Genome Browser
Species Human (GRCh38)
Location 1:51060502-51060524
Sequence ATTGCCTGCAGTGTGACGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907020332_907020335 9 Left 907020332 1:51060502-51060524 CCACTCGTCACACTGCAGGCAAT No data
Right 907020335 1:51060534-51060556 AGAAGAGCTGCAGCCCTTCAGGG 0: 33
1: 68
2: 198
3: 270
4: 820
907020332_907020338 25 Left 907020332 1:51060502-51060524 CCACTCGTCACACTGCAGGCAAT No data
Right 907020338 1:51060550-51060572 TTCAGGGAGCTCAGATGCACAGG No data
907020332_907020334 8 Left 907020332 1:51060502-51060524 CCACTCGTCACACTGCAGGCAAT No data
Right 907020334 1:51060533-51060555 GAGAAGAGCTGCAGCCCTTCAGG 0: 58
1: 114
2: 245
3: 272
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907020332 Original CRISPR ATTGCCTGCAGTGTGACGAG TGG (reversed) Intergenic
No off target data available for this crispr