ID: 907020332

View in Genome Browser
Species Human (GRCh38)
Location 1:51060502-51060524
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907020332_907020334 8 Left 907020332 1:51060502-51060524 CCACTCGTCACACTGCAGGCAAT No data
Right 907020334 1:51060533-51060555 GAGAAGAGCTGCAGCCCTTCAGG No data
907020332_907020335 9 Left 907020332 1:51060502-51060524 CCACTCGTCACACTGCAGGCAAT No data
Right 907020335 1:51060534-51060556 AGAAGAGCTGCAGCCCTTCAGGG No data
907020332_907020338 25 Left 907020332 1:51060502-51060524 CCACTCGTCACACTGCAGGCAAT No data
Right 907020338 1:51060550-51060572 TTCAGGGAGCTCAGATGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907020332 Original CRISPR ATTGCCTGCAGTGTGACGAG TGG (reversed) Intergenic