ID: 907020334

View in Genome Browser
Species Human (GRCh38)
Location 1:51060533-51060555
Sequence GAGAAGAGCTGCAGCCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907020332_907020334 8 Left 907020332 1:51060502-51060524 CCACTCGTCACACTGCAGGCAAT No data
Right 907020334 1:51060533-51060555 GAGAAGAGCTGCAGCCCTTCAGG No data
907020331_907020334 9 Left 907020331 1:51060501-51060523 CCCACTCGTCACACTGCAGGCAA No data
Right 907020334 1:51060533-51060555 GAGAAGAGCTGCAGCCCTTCAGG No data
907020328_907020334 13 Left 907020328 1:51060497-51060519 CCACCCCACTCGTCACACTGCAG No data
Right 907020334 1:51060533-51060555 GAGAAGAGCTGCAGCCCTTCAGG No data
907020327_907020334 16 Left 907020327 1:51060494-51060516 CCTCCACCCCACTCGTCACACTG No data
Right 907020334 1:51060533-51060555 GAGAAGAGCTGCAGCCCTTCAGG No data
907020330_907020334 10 Left 907020330 1:51060500-51060522 CCCCACTCGTCACACTGCAGGCA No data
Right 907020334 1:51060533-51060555 GAGAAGAGCTGCAGCCCTTCAGG No data
907020326_907020334 20 Left 907020326 1:51060490-51060512 CCTGCCTCCACCCCACTCGTCAC No data
Right 907020334 1:51060533-51060555 GAGAAGAGCTGCAGCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907020334 Original CRISPR GAGAAGAGCTGCAGCCCTTC AGG Intergenic