ID: 907020338

View in Genome Browser
Species Human (GRCh38)
Location 1:51060550-51060572
Sequence TTCAGGGAGCTCAGATGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907020328_907020338 30 Left 907020328 1:51060497-51060519 CCACCCCACTCGTCACACTGCAG No data
Right 907020338 1:51060550-51060572 TTCAGGGAGCTCAGATGCACAGG No data
907020330_907020338 27 Left 907020330 1:51060500-51060522 CCCCACTCGTCACACTGCAGGCA No data
Right 907020338 1:51060550-51060572 TTCAGGGAGCTCAGATGCACAGG No data
907020331_907020338 26 Left 907020331 1:51060501-51060523 CCCACTCGTCACACTGCAGGCAA No data
Right 907020338 1:51060550-51060572 TTCAGGGAGCTCAGATGCACAGG No data
907020332_907020338 25 Left 907020332 1:51060502-51060524 CCACTCGTCACACTGCAGGCAAT No data
Right 907020338 1:51060550-51060572 TTCAGGGAGCTCAGATGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907020338 Original CRISPR TTCAGGGAGCTCAGATGCAC AGG Intergenic