ID: 907023080

View in Genome Browser
Species Human (GRCh38)
Location 1:51087419-51087441
Sequence GGAAATCCTGTATTTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907023080_907023086 15 Left 907023080 1:51087419-51087441 CCTTTGAGAAATACAGGATTTCC No data
Right 907023086 1:51087457-51087479 TAGTAATCTCAGTGGTGATGAGG No data
907023080_907023088 23 Left 907023080 1:51087419-51087441 CCTTTGAGAAATACAGGATTTCC No data
Right 907023088 1:51087465-51087487 TCAGTGGTGATGAGGGCTGCTGG No data
907023080_907023089 24 Left 907023080 1:51087419-51087441 CCTTTGAGAAATACAGGATTTCC No data
Right 907023089 1:51087466-51087488 CAGTGGTGATGAGGGCTGCTGGG No data
907023080_907023085 7 Left 907023080 1:51087419-51087441 CCTTTGAGAAATACAGGATTTCC No data
Right 907023085 1:51087449-51087471 GAGGACTGTAGTAATCTCAGTGG No data
907023080_907023087 16 Left 907023080 1:51087419-51087441 CCTTTGAGAAATACAGGATTTCC No data
Right 907023087 1:51087458-51087480 AGTAATCTCAGTGGTGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907023080 Original CRISPR GGAAATCCTGTATTTCTCAA AGG (reversed) Intergenic
No off target data available for this crispr