ID: 907023084

View in Genome Browser
Species Human (GRCh38)
Location 1:51087441-51087463
Sequence ATTACTACAGTCCTCACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907023084_907023087 -6 Left 907023084 1:51087441-51087463 CCAGTGGTGAGGACTGTAGTAAT No data
Right 907023087 1:51087458-51087480 AGTAATCTCAGTGGTGATGAGGG No data
907023084_907023086 -7 Left 907023084 1:51087441-51087463 CCAGTGGTGAGGACTGTAGTAAT No data
Right 907023086 1:51087457-51087479 TAGTAATCTCAGTGGTGATGAGG No data
907023084_907023088 1 Left 907023084 1:51087441-51087463 CCAGTGGTGAGGACTGTAGTAAT No data
Right 907023088 1:51087465-51087487 TCAGTGGTGATGAGGGCTGCTGG No data
907023084_907023089 2 Left 907023084 1:51087441-51087463 CCAGTGGTGAGGACTGTAGTAAT No data
Right 907023089 1:51087466-51087488 CAGTGGTGATGAGGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907023084 Original CRISPR ATTACTACAGTCCTCACCAC TGG (reversed) Intergenic
No off target data available for this crispr