ID: 907023089

View in Genome Browser
Species Human (GRCh38)
Location 1:51087466-51087488
Sequence CAGTGGTGATGAGGGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907023084_907023089 2 Left 907023084 1:51087441-51087463 CCAGTGGTGAGGACTGTAGTAAT No data
Right 907023089 1:51087466-51087488 CAGTGGTGATGAGGGCTGCTGGG No data
907023080_907023089 24 Left 907023080 1:51087419-51087441 CCTTTGAGAAATACAGGATTTCC No data
Right 907023089 1:51087466-51087488 CAGTGGTGATGAGGGCTGCTGGG No data
907023083_907023089 3 Left 907023083 1:51087440-51087462 CCCAGTGGTGAGGACTGTAGTAA No data
Right 907023089 1:51087466-51087488 CAGTGGTGATGAGGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907023089 Original CRISPR CAGTGGTGATGAGGGCTGCT GGG Intergenic
No off target data available for this crispr