ID: 907024677

View in Genome Browser
Species Human (GRCh38)
Location 1:51104649-51104671
Sequence AAGGGCCAATTGTAAGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907024677 Original CRISPR AAGGGCCAATTGTAAGCTGG AGG Intronic
902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG + Intergenic
903732192 1:25504856-25504878 AGGGGCCAAGTGCCAGCTGGGGG - Intergenic
907024677 1:51104649-51104671 AAGGGCCAATTGTAAGCTGGAGG + Intronic
912682304 1:111737163-111737185 AAGGGCCAAATGAAAGCTAATGG + Intronic
914764991 1:150629764-150629786 AAGGACCAATTGGAAGCCTGTGG + Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067907339 10:50307206-50307228 AAAGGCCAATGGTAAGATCGAGG + Exonic
1069650703 10:70045614-70045636 AAGGGACCATTGTAAGCTACTGG + Intergenic
1071817045 10:89242912-89242934 AAGAGCCTAATGTAGGCTGGTGG + Intronic
1071845078 10:89513747-89513769 CAGGGCTAATTGTCAGCTGGTGG - Intronic
1074467261 10:113694486-113694508 ATGGGAGAATTGTGAGCTGGAGG + Intronic
1076775387 10:132693511-132693533 ATGGGCCAAAAGAAAGCTGGAGG + Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1078511710 11:11989005-11989027 AAGTGCCCAATGTAAGCTGAAGG - Intronic
1083465423 11:62842440-62842462 AAGGGCCAGATGTTTGCTGGCGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1086050701 11:82586873-82586895 AGGGGCCAAATCTAATCTGGTGG + Intergenic
1087979131 11:104589510-104589532 ATGGGCCTAGTGTAAGATGGTGG + Intergenic
1089564098 11:119361790-119361812 AAAGGCCAATTGGCAGCAGGTGG + Intronic
1091054648 11:132406718-132406740 AAGGGTGCAGTGTAAGCTGGTGG + Intergenic
1092281824 12:7103241-7103263 AAGGGCAAAAAGAAAGCTGGAGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093244072 12:16713718-16713740 AATGGCCAAGAGTCAGCTGGAGG - Intergenic
1094250431 12:28353882-28353904 TGGGGCCAATTGGAAGGTGGAGG + Intronic
1096289940 12:50333558-50333580 AAAGGCCATTTGAAAGATGGAGG + Intronic
1097329774 12:58320018-58320040 AAGGGGAAATTGTAACCTGTAGG + Intergenic
1098224891 12:68311277-68311299 AAGGGGCCATTTTAAGTTGGTGG - Intronic
1099770620 12:87049041-87049063 AATGGCCGATTCTAACCTGGAGG + Intergenic
1101612884 12:106308035-106308057 AAGGCCCAGTTGTAATGTGGAGG + Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108930071 13:55807139-55807161 AAGGGCCCAGTGTAACCTGTTGG + Intergenic
1109072987 13:57792733-57792755 AAGGGTCTATTGTAAGTTTGTGG + Intergenic
1112725442 13:102298745-102298767 AAGTGCCACATGAAAGCTGGAGG + Intronic
1112896615 13:104306900-104306922 AAGGGGCAGTAGGAAGCTGGGGG + Intergenic
1115304655 14:31921877-31921899 AAGGACCAATTTTAAGCCTGTGG - Intergenic
1118505239 14:66403921-66403943 CAAGGCTAATTGTAAGCTGCAGG - Intergenic
1120673060 14:87386657-87386679 AAGTGACAAGTGTTAGCTGGGGG + Intergenic
1124578362 15:30928864-30928886 AAGGTCTAAATGTAAGGTGGAGG - Intronic
1126181153 15:45786140-45786162 CAGGGCCATTTGTGAGGTGGAGG + Intergenic
1126488803 15:49213513-49213535 CAGGGCCAATTGTGGGGTGGAGG - Intronic
1127295415 15:57604687-57604709 AAGGGCCTATTGTGAGCAGCTGG + Intronic
1127775590 15:62262022-62262044 AAGGGCAAATGGGGAGCTGGGGG - Intergenic
1131107898 15:89747192-89747214 ACGGGCCAACTGTGGGCTGGTGG - Intergenic
1131632840 15:94197334-94197356 CAGGGCCAATTGTGAGAGGGAGG + Intergenic
1136744843 16:32577130-32577152 AGGGGCCTATTGTGAGGTGGGGG - Intergenic
1203024754 16_KI270728v1_random:498092-498114 AGGGGCCTATTGTGAGGTGGGGG + Intergenic
1203046967 16_KI270728v1_random:836339-836361 AGGGGCCTATTGTGAGGTGGGGG - Intergenic
1146111193 17:30091201-30091223 AAGGTCCAATAGCAAGCTGGTGG + Intronic
1147383100 17:40067209-40067231 AAGGGCTCCTTGTAAGCTGAAGG - Intronic
1149698166 17:58633441-58633463 AATGGCCAATTGTAAGCCATAGG + Intronic
1150326387 17:64262035-64262057 AGGAGCCAGGTGTAAGCTGGAGG - Intronic
1153365888 18:4255577-4255599 AAGTGCCAATTTTAAGCATGGGG + Intronic
1162195892 19:8984417-8984439 AAGGGCCTATTGGAGGGTGGAGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
926562371 2:14431995-14432017 CAGGGCCAAATGGCAGCTGGGGG + Intergenic
926698803 2:15788809-15788831 AAGGGCCAATTGTAACCACATGG + Intergenic
929570825 2:43021950-43021972 AAGGCCCCATTCTCAGCTGGCGG + Intergenic
932001673 2:67890811-67890833 AAGGGCCTATTTTGAGCGGGGGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
933602892 2:84351077-84351099 TGGGGCCTATTGTAAGGTGGAGG + Intergenic
937346105 2:121126448-121126470 AAGGGCCACTTGGAAGCTTCTGG + Intergenic
937551720 2:123101186-123101208 AATGGCCAATTCTAACCTGAAGG - Intergenic
938685877 2:133737168-133737190 AATGGCCAGTTGTAAGCATGGGG + Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940907186 2:159179889-159179911 CAGGGCCAAGTGGAAGTTGGGGG - Intronic
941009900 2:160287448-160287470 AAGGGACCATTTTAAGTTGGGGG - Intronic
944494916 2:200296983-200297005 AAGGGTTATCTGTAAGCTGGAGG - Intergenic
944994287 2:205276564-205276586 AAGGGCCATTTGTGAGATGGTGG - Intronic
946048141 2:216838177-216838199 AAGAGACAATTGGAGGCTGGTGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1175086893 20:56467298-56467320 AAGGGCTATATGTAAGCTTGGGG - Intergenic
1175768555 20:61608025-61608047 AAGGCTCAGTTGTAAACTGGTGG - Intronic
1177892894 21:26827586-26827608 AATGGCCATTTGGAAGCAGGAGG + Intergenic
1179146530 21:38773323-38773345 AAGGGCAAATTGGAAGTGGGTGG - Intergenic
1180942676 22:19669725-19669747 AAGGGCCAAGTCCAAGCTAGAGG - Intergenic
1182612054 22:31556821-31556843 AGGGGTCACTTGTAGGCTGGAGG + Intronic
956945553 3:74218485-74218507 AAGGGCTACTTGGAGGCTGGTGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
959358072 3:105357240-105357262 ATGGTACAATTGTATGCTGGAGG - Intergenic
963079707 3:141379462-141379484 AAGGCACAGTTGGAAGCTGGAGG - Intronic
966114710 3:176448018-176448040 AGGGGCCATTTGTAAGGTAGGGG + Intergenic
967620853 3:191631935-191631957 AAGGTCCCATAGCAAGCTGGTGG + Intergenic
969479476 4:7440445-7440467 AAGGGCCAATGGTGAAATGGGGG - Intronic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
979018221 4:115461722-115461744 TAGGGCCTATTGTAAGGTGGAGG + Intergenic
980398865 4:132253432-132253454 TAGGGCCTATTGGAAGGTGGAGG - Intergenic
983663429 4:170155476-170155498 AAAGGCCAAATGTAAGCTTCTGG - Intergenic
986598959 5:9452104-9452126 CAGGGCCAATTCTGAGCTGTAGG - Intronic
988369634 5:30349468-30349490 AGGGGAGAATTTTAAGCTGGAGG + Intergenic
988403724 5:30796731-30796753 AAGGGCCCATTGTATGCAGAGGG + Intergenic
989510862 5:42286473-42286495 AATAGAGAATTGTAAGCTGGTGG + Intergenic
995152176 5:108861117-108861139 AAAGGAAAATTGTAAGGTGGTGG + Intronic
995554114 5:113310064-113310086 AAGGGCCAAGAGTAGGCTGCTGG - Intronic
995647611 5:114330206-114330228 AATGGCCACTTCTTAGCTGGAGG - Intergenic
995650100 5:114361140-114361162 AAGGCGCAAATGTGAGCTGGCGG + Exonic
998984792 5:147744313-147744335 AAGGGTCATGTGGAAGCTGGTGG - Intronic
999198425 5:149799027-149799049 AAGAGCCAAGTGTGACCTGGTGG + Intronic
1000683420 5:164216123-164216145 AAGGGTCAGTTGTAAGATGAAGG - Intergenic
1002454158 5:179336831-179336853 AGGGGCCTATTGTGGGCTGGAGG - Intronic
1004086281 6:12452705-12452727 AAATGCCAATTGGAAACTGGAGG - Intergenic
1005254422 6:23985366-23985388 AAAGGCCAAATGTGAGCTGATGG - Intergenic
1007990646 6:46251824-46251846 AACGGCCAATTCTAACTTGGTGG - Intronic
1009454163 6:63835040-63835062 CAGGGCCTATTGTAGGGTGGGGG + Intronic
1015265917 6:131292392-131292414 AAGGGCCCATGGTCAGCTGTTGG - Intergenic
1018156254 6:160988046-160988068 CAGGGCCTATTGGAAGGTGGAGG + Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020525968 7:9259385-9259407 CATGGCCAATTGCAAGCTGCAGG - Intergenic
1020815464 7:12900522-12900544 ATTAGCCAATTGTAAGGTGGGGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1032257952 7:130311871-130311893 AAGGCCCAACTGTAAACTGAGGG - Intronic
1034022366 7:147658789-147658811 AAGGGTCAGTGGGAAGCTGGAGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038371647 8:26999365-26999387 AAGGGCCAATCTTAGGCTGCAGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1040568285 8:48586307-48586329 AAAGTCCAAGTCTAAGCTGGAGG + Intergenic
1040672759 8:49712451-49712473 CAGGGCCTATTGGAAGGTGGAGG + Intergenic
1046476368 8:114749893-114749915 AAGGGAAAAGTGTAAGCAGGAGG - Intergenic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1051228711 9:14930772-14930794 ATCTGCCACTTGTAAGCTGGAGG - Intergenic
1051399884 9:16669331-16669353 TAGGGCAAAATGTAACCTGGGGG - Intronic
1055360065 9:75480132-75480154 AAAGGCAAATTGAAAACTGGGGG - Intergenic
1056813547 9:89782841-89782863 AAGGGCCACTTCCAAGCTGTAGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1060280415 9:122212324-122212346 AAGGGCCCACTGTAAGTTAGTGG - Intronic
1061064139 9:128267073-128267095 AAGGGCGAATGGGGAGCTGGGGG - Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185604923 X:1363193-1363215 AAGGCCCCATTGTAAGGTGCTGG + Intronic
1186811972 X:13199198-13199220 GCGGGACAATTGGAAGCTGGGGG - Intergenic
1187840072 X:23477610-23477632 ATGGGCCATCTGTAAGATGGGGG - Intergenic
1189423546 X:40878391-40878413 AAGGACTAAGTGTAAGATGGGGG - Intergenic
1189624520 X:42882067-42882089 GAGGGCAAATTGTAATTTGGAGG - Intergenic
1195274186 X:103263964-103263986 TGGGGCCAATTGTAGGGTGGGGG + Intergenic
1196186337 X:112748593-112748615 AAGGGCTAATTATGAGTTGGGGG + Intergenic