ID: 907026419

View in Genome Browser
Species Human (GRCh38)
Location 1:51124635-51124657
Sequence GAGTGGATCAATGCAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 1, 2: 3, 3: 15, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907026414_907026419 4 Left 907026414 1:51124608-51124630 CCCACATTCAATTACATGCAAAT 0: 1
1: 27
2: 116
3: 217
4: 546
Right 907026419 1:51124635-51124657 GAGTGGATCAATGCAAATGGAGG 0: 1
1: 1
2: 3
3: 15
4: 116
907026415_907026419 3 Left 907026415 1:51124609-51124631 CCACATTCAATTACATGCAAATT 0: 1
1: 23
2: 102
3: 238
4: 538
Right 907026419 1:51124635-51124657 GAGTGGATCAATGCAAATGGAGG 0: 1
1: 1
2: 3
3: 15
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907026419 Original CRISPR GAGTGGATCAATGCAAATGG AGG Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
902284550 1:15398688-15398710 GAGTGCAGCAAGGAAAATGGGGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906195146 1:43925651-43925673 GAGCTGATCAAGGCAAATGCAGG - Intronic
906436995 1:45804225-45804247 GAGTGGAGAAATGGAAGTGGTGG + Intronic
907026419 1:51124635-51124657 GAGTGGATCAATGCAAATGGAGG + Intronic
907353025 1:53849081-53849103 AGGTGGATCAGTGCAAATGTGGG + Intergenic
907859255 1:58335464-58335486 GACTGGAGCAAGGCAAGTGGGGG + Intronic
910474460 1:87591865-87591887 GAGTTGAGCAATGGGAATGGAGG + Intergenic
910897195 1:92081271-92081293 GTGAGGACCAAAGCAAATGGAGG + Intronic
920624146 1:207579625-207579647 GAGTGGATCAATGCAGATTGAGG - Intronic
920881478 1:209884558-209884580 TAGTGGATCAATGAAAGGGGTGG - Intergenic
921447388 1:215262630-215262652 AAATGGATCAATGCAAAAAGTGG - Intergenic
921802405 1:219416615-219416637 AGGTTGATCAATGCAAATTGAGG + Intergenic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065869989 10:29947911-29947933 GGGTGGCTCAATGCAACTGATGG + Intergenic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1067364720 10:45615090-45615112 CAGAGGAGCTATGCAAATGGGGG - Intergenic
1068787582 10:60993072-60993094 GTGTGTAACAATGGAAATGGTGG + Intronic
1069946501 10:71989791-71989813 GACTGGATCCATGCAAATGCTGG - Intronic
1078913529 11:15756168-15756190 GAGTGAAGCAAGGCAAATGAAGG + Intergenic
1080888297 11:36386814-36386836 GAGGGAATAGATGCAAATGGAGG + Intronic
1081703511 11:45166499-45166521 GAGTGGAGCATTGGAGATGGGGG + Intronic
1082891816 11:58147240-58147262 GAGTGGACCAATGAAAAGGTGGG - Intronic
1083015128 11:59445181-59445203 GAGGGGAACAATGCACATTGGGG - Intergenic
1086371343 11:86158428-86158450 GAGTGAATAAATGAAAATGGTGG - Intergenic
1090858340 11:130631201-130631223 GAGTGGTTTATTGTAAATGGAGG + Intergenic
1091179202 11:133588337-133588359 GAGAGGATCAAGGCAAAAAGGGG - Intergenic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096421493 12:51462416-51462438 GGGTGGCTCAATTCTAATGGAGG - Exonic
1096912432 12:54997920-54997942 CAGAGGATCAATCTAAATGGGGG - Intergenic
1103134331 12:118494611-118494633 GAGTGGATGAATGGATATGTCGG - Intergenic
1105568526 13:21576630-21576652 GAGTGGGTCACAGAAAATGGGGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106567537 13:30899169-30899191 GAGTGGATCTCTGCAAATCTGGG + Intergenic
1106716961 13:32400421-32400443 GAGTGGATCACTGCAAAATTAGG - Intergenic
1108976721 13:56453596-56453618 GAGGGGAACAATGCACATTGGGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1113374139 13:109748454-109748476 AAATGGATCAATGTAAATGAAGG + Intergenic
1114267401 14:21081046-21081068 AAGTGAATAAATGGAAATGGGGG - Intronic
1117472983 14:56065336-56065358 GAGAGGAACAATGCACATTGGGG + Intergenic
1118824253 14:69366209-69366231 GAGTGGATGCATGCCCATGGGGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1125796874 15:42409847-42409869 GAGTTGCTCAAACCAAATGGGGG + Intronic
1129943940 15:79523136-79523158 GAGTGGAATCATGCAAATGGAGG - Intergenic
1130054796 15:80513229-80513251 GAGAGGATCATTGTAAAGGGAGG + Intronic
1131890722 15:96969162-96969184 AGGTGGATCAATGCAGATGTGGG + Intergenic
1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG + Intergenic
1140199556 16:72883791-72883813 AAGTGCATCAAAACAAATGGGGG - Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1153469142 18:5423737-5423759 GAGAGGATATATGCAAATGAGGG + Intronic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159246992 18:65819232-65819254 GAGTGGGTCAATGCAGATTGAGG - Intronic
1160821830 19:1062526-1062548 GGGTGGACCAATGAGAATGGTGG - Intronic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1165642102 19:37398457-37398479 TAGTGGAGCCATGCAGATGGGGG - Intergenic
1166513337 19:43426206-43426228 GTGTGGATTAATGCAAATTAAGG - Intergenic
926717736 2:15938632-15938654 GCATGGATCATTACAAATGGAGG + Intergenic
929980498 2:46674794-46674816 GAGATGATTAATGCAGATGGAGG - Intergenic
930521199 2:52469870-52469892 GAGAGAATGAGTGCAAATGGGGG - Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931016653 2:57989087-57989109 AATTGGATCCATGCAAATTGGGG - Intronic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
937889946 2:126931152-126931174 GAGTGTTCCAATGCCAATGGTGG + Intergenic
945178338 2:207066120-207066142 GAGTGGGTCAATGCAAGAGTTGG + Intergenic
1172555028 20:35833413-35833435 GAGGGGATATATGCACATGGTGG - Intronic
1173403883 20:42748421-42748443 GAGTGGAACAAAGCAAAGGCTGG - Intronic
1173866082 20:46313449-46313471 GAATGAATGAATGCAAATGCTGG + Intergenic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1175685640 20:61026218-61026240 GAGTGGAACAATGCACACTGAGG - Intergenic
1176521122 21:7825339-7825361 CATTGGATCCATGCACATGGGGG + Intronic
1177108991 21:17000623-17000645 TAGTGGATTCATGGAAATGGGGG + Intergenic
1177673494 21:24266225-24266247 GATGTGATCAGTGCAAATGGAGG + Intergenic
1178114301 21:29401521-29401543 AAGTTGATCAATGCTAATGCAGG - Intronic
1178655142 21:34455351-34455373 CATTGGATCCATGCACATGGGGG + Intergenic
1178722107 21:35019157-35019179 GAGTGGATCACTTCAAATGAAGG - Intronic
1178997037 21:37412121-37412143 AAGTGGATGAAGGCAAATTGAGG + Intronic
1181029324 22:20142359-20142381 AAGTGGATCAGGGCAAATGTGGG - Intronic
1181918689 22:26302015-26302037 GAGTGGATCCATGGAAATCAAGG + Intronic
960936775 3:122909412-122909434 GAGAGGATCAATGCCATAGGAGG - Exonic
967039240 3:185674288-185674310 GAGTTGATAACTGCAAAAGGTGG + Intronic
968035151 3:195542446-195542468 GTGTGGCACAATGCTAATGGGGG + Intronic
970373958 4:15437631-15437653 GAGTGGATCTATGAATGTGGTGG - Intronic
970663752 4:18314081-18314103 GAGTGGTTCCATGAAAAAGGTGG - Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
974836423 4:67256680-67256702 GAGTAGTTCAATGCAAATTTAGG + Intergenic
977038585 4:91984754-91984776 CAGTGGAACAAGGCAACTGGCGG + Intergenic
978440627 4:108729921-108729943 GGGTGGGGCAATGCATATGGAGG + Intergenic
982371892 4:154642715-154642737 GAGTGGGTCAATATAAATTGAGG - Intronic
986884271 5:12214842-12214864 TAGTGGATAAATGCAAACTGTGG - Intergenic
992686107 5:79201304-79201326 GAAAGGATTAATGCAAGTGGCGG + Intronic
993091067 5:83427157-83427179 GAATGGAACAGTGCAAATGTAGG - Intergenic
996292115 5:121863899-121863921 TAGTGGAACAATGCAAAGTGAGG - Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
999044985 5:148457345-148457367 GAGTAAATTAATGCAAATGGGGG - Intronic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1001679942 5:173549103-173549125 GAGTGGGACTGTGCAAATGGAGG - Intergenic
1003399358 6:5779076-5779098 GAGTGGAACAAGGCAGACGGTGG - Intergenic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1011167927 6:84471114-84471136 AAGCACATCAATGCAAATGGTGG + Intergenic
1011791067 6:90899530-90899552 GACTGGATCAATTCAAATACAGG - Intergenic
1014634040 6:123823045-123823067 CAGAGGACCAATTCAAATGGAGG + Intronic
1022067613 7:26875908-26875930 GCTTGGCTCACTGCAAATGGGGG - Intronic
1023672204 7:42589135-42589157 GAGAGGAACAATGCACATTGGGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1027302043 7:76849718-76849740 GAGTAGATCAAGGTTAATGGAGG + Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1031906990 7:127471328-127471350 TAGTGAATCATTGCACATGGGGG - Intergenic
1033501312 7:141952780-141952802 GATTTGATCAAGGAAAATGGGGG - Intronic
1038380988 8:27093776-27093798 GTGAGGATAAATGCAAAGGGGGG - Intergenic
1041103435 8:54418988-54419010 GCGGGGATCAAAGCAAAAGGAGG - Intergenic
1041190837 8:55352436-55352458 AAGTCAATCAATGCAAATGAAGG - Intronic
1042411306 8:68469379-68469401 GAGCGGACCAAGGCACATGGAGG - Intronic
1042594072 8:70426744-70426766 GAGTGAATGAATGAATATGGTGG + Intergenic
1045614411 8:103891791-103891813 GAGAGGGTGAATGGAAATGGTGG + Intronic
1047809663 8:128394700-128394722 TTGTGGCTTAATGCAAATGGAGG - Intergenic
1050806266 9:9682523-9682545 GGGTAGATCAATGCAAGTGTGGG + Intronic
1051859737 9:21610693-21610715 GAGTGAATCAATGCTGATGCTGG + Intergenic
1059202793 9:112433637-112433659 GAGTGAGGCAATGAAAATGGAGG + Intronic
1061593934 9:131616532-131616554 GTGTGGAACAATTTAAATGGAGG - Intronic
1192962801 X:76148038-76148060 AAATGGATGGATGCAAATGGTGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195713500 X:107795350-107795372 GAGTAGAGAAGTGCAAATGGGGG - Intergenic
1197710323 X:129661692-129661714 TACTGGATCAATGCAAAAAGTGG + Intergenic
1198257700 X:134939124-134939146 GAGTTGATCAATGCATGGGGTGG - Intergenic
1199554353 X:149090383-149090405 CAGTGGATCAGTGCAGATGTGGG + Intergenic