ID: 907030433

View in Genome Browser
Species Human (GRCh38)
Location 1:51165824-51165846
Sequence GACTCAGTTATAGTGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907030433_907030437 19 Left 907030433 1:51165824-51165846 CCAGCCAGCACTATAACTGAGTC No data
Right 907030437 1:51165866-51165888 TTGTATTAGGCTATTACTTCAGG No data
907030433_907030435 6 Left 907030433 1:51165824-51165846 CCAGCCAGCACTATAACTGAGTC No data
Right 907030435 1:51165853-51165875 ACTCCTTTTACTATTGTATTAGG No data
907030433_907030438 20 Left 907030433 1:51165824-51165846 CCAGCCAGCACTATAACTGAGTC No data
Right 907030438 1:51165867-51165889 TGTATTAGGCTATTACTTCAGGG No data
907030433_907030440 27 Left 907030433 1:51165824-51165846 CCAGCCAGCACTATAACTGAGTC No data
Right 907030440 1:51165874-51165896 GGCTATTACTTCAGGGTAATGGG No data
907030433_907030439 26 Left 907030433 1:51165824-51165846 CCAGCCAGCACTATAACTGAGTC No data
Right 907030439 1:51165873-51165895 AGGCTATTACTTCAGGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907030433 Original CRISPR GACTCAGTTATAGTGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr