ID: 907030505

View in Genome Browser
Species Human (GRCh38)
Location 1:51166417-51166439
Sequence TCTTCTGATGTTCCTCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907030504_907030505 -9 Left 907030504 1:51166403-51166425 CCTGACTATTAACATCTTCTGAT No data
Right 907030505 1:51166417-51166439 TCTTCTGATGTTCCTCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907030505 Original CRISPR TCTTCTGATGTTCCTCATTG AGG Intergenic
No off target data available for this crispr