ID: 907031353

View in Genome Browser
Species Human (GRCh38)
Location 1:51175403-51175425
Sequence TGAGTTCCCGACTTACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907031353_907031356 10 Left 907031353 1:51175403-51175425 CCAGGCAGTAAGTCGGGAACTCA No data
Right 907031356 1:51175436-51175458 TCATTTACTTCCTGTATCTTAGG No data
907031353_907031357 11 Left 907031353 1:51175403-51175425 CCAGGCAGTAAGTCGGGAACTCA No data
Right 907031357 1:51175437-51175459 CATTTACTTCCTGTATCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907031353 Original CRISPR TGAGTTCCCGACTTACTGCC TGG (reversed) Intergenic
No off target data available for this crispr