ID: 907038194

View in Genome Browser
Species Human (GRCh38)
Location 1:51235406-51235428
Sequence CTGATGAGAAGCAGAAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 405}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907038186_907038194 30 Left 907038186 1:51235353-51235375 CCCCAGGGGAAATGAAGTTGCAT 0: 1
1: 0
2: 0
3: 20
4: 162
Right 907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG 0: 1
1: 0
2: 5
3: 24
4: 405
907038190_907038194 7 Left 907038190 1:51235376-51235398 CCAGAAGGATTCCTGAGAATAAT 0: 1
1: 0
2: 2
3: 14
4: 171
Right 907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG 0: 1
1: 0
2: 5
3: 24
4: 405
907038191_907038194 -4 Left 907038191 1:51235387-51235409 CCTGAGAATAATGATTAGCCTGA 0: 1
1: 0
2: 1
3: 12
4: 114
Right 907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG 0: 1
1: 0
2: 5
3: 24
4: 405
907038187_907038194 29 Left 907038187 1:51235354-51235376 CCCAGGGGAAATGAAGTTGCATC 0: 1
1: 0
2: 0
3: 19
4: 189
Right 907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG 0: 1
1: 0
2: 5
3: 24
4: 405
907038188_907038194 28 Left 907038188 1:51235355-51235377 CCAGGGGAAATGAAGTTGCATCC 0: 1
1: 0
2: 0
3: 7
4: 143
Right 907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG 0: 1
1: 0
2: 5
3: 24
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907038194 Original CRISPR CTGATGAGAAGCAGAAAGGT TGG Intergenic
900252167 1:1676628-1676650 CCGAAGAGAAGCCGAAAGGCAGG - Exonic
900262577 1:1739486-1739508 CCGAAGAGAAGCCGAAAGGCAGG - Exonic
900737023 1:4305380-4305402 CTGGTGATGATCAGAAAGGTGGG + Intergenic
901909946 1:12448557-12448579 CTGATGAAGAGCTGAAAGGCAGG + Intronic
902507191 1:16946214-16946236 ATGAGGAAAGGCAGAAAGGTCGG - Intronic
903395668 1:23000097-23000119 CTGATGAGAAGGAGAAAAACTGG + Intergenic
903541070 1:24096632-24096654 CTGATGAGAGGCAGGGAGGGTGG + Intronic
903745044 1:25581267-25581289 ATTCTGAGAAGCAGAGAGGTAGG + Intergenic
906732778 1:48097591-48097613 CTGAGGAGAAGCAGATTGGAGGG - Intergenic
906746523 1:48225925-48225947 GTGGTGAGAAGGAGAAGGGTGGG - Intronic
906972726 1:50534064-50534086 CTAATTAGAAGCTGGAAGGTAGG - Intronic
907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG + Intergenic
907802480 1:57783894-57783916 CTGAAGAGAAGGAGAGAGATTGG - Intronic
909015049 1:70371825-70371847 CTGATGAGAAGGAGAAAAACTGG - Intronic
909824156 1:80105051-80105073 CTGAAGAGAGGGAGAGAGGTGGG + Intergenic
910375054 1:86559325-86559347 CTTAGGAGAAGCAGCTAGGTTGG - Intronic
910381562 1:86632368-86632390 TTAATGACAGGCAGAAAGGTCGG - Intergenic
911591413 1:99752437-99752459 CTGAGGAGAAGGAGAGAGATTGG + Intronic
912248174 1:107983053-107983075 CTGATGAGAAGTAGACAGCGTGG - Intergenic
912902512 1:113667864-113667886 CTGAGGAGAGGGAGAAAGATGGG + Intronic
913404287 1:118472086-118472108 CAGATGAGAACAAGAAAGATCGG + Intergenic
914356759 1:146892283-146892305 CTGTGGAGAAGCAGAAAAATGGG + Intergenic
915855428 1:159379789-159379811 CTGAGGAGAAGCAGAAAGATGGG + Intergenic
917766446 1:178223768-178223790 ATGGTGAGAAGTAGATAGGTTGG + Intronic
917826163 1:178823448-178823470 CTGAAGAAAAGTAGAAAGGAAGG + Intronic
917958594 1:180125171-180125193 GTGAGCAGAAGCAGAAAGGCAGG + Intergenic
918412338 1:184272853-184272875 CTGAAGAGAAGAAGTAAGGGAGG - Intergenic
918999272 1:191808198-191808220 AAGATGAGAGGCAGAAAGGGAGG + Intergenic
919814988 1:201431567-201431589 CTGATGAGCAGCAAAGAGATGGG - Intergenic
919885904 1:201934587-201934609 CTAATGGGAAGCAGAATAGTAGG - Intronic
920501093 1:206485912-206485934 CTGGTCAGAAGCGGCAAGGTAGG - Intronic
920534808 1:206730581-206730603 CTCATGATAGGCTGAAAGGTTGG + Intronic
921402625 1:214743043-214743065 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
921826050 1:219673121-219673143 CAGAAGAGAAGCAAAAAGGAGGG + Intergenic
923163904 1:231341089-231341111 CAGATGATAAAGAGAAAGGTAGG + Intronic
924287580 1:242503856-242503878 CTGATGCGGAGCAGAAAGGTGGG + Intronic
924506683 1:244692589-244692611 CTGCTAAGAATCAGAAAGCTGGG - Intronic
1062822128 10:542271-542293 CTGCTGAGAAGCAGAAAGCATGG + Intronic
1063122724 10:3115837-3115859 CTGAGGAGTGGCAGAGAGGTGGG + Intronic
1065101754 10:22337756-22337778 CTGATAACTAGCAGAAAGCTTGG + Intergenic
1065150083 10:22813576-22813598 CTGATGAGAGGCAGGGAGATTGG + Intergenic
1065456724 10:25914152-25914174 CCAATGAGAAGGAGAAAGATGGG + Intergenic
1067763568 10:49069025-49069047 CTGAAAAGAAGAAGAAAGGGTGG - Intronic
1068248283 10:54402799-54402821 CTGAAGAGATGGAGAAAGATGGG - Intronic
1068396053 10:56463642-56463664 CTGAAAAAAAGAAGAAAGGTTGG + Intergenic
1068844774 10:61659351-61659373 CTGATGGGACCCATAAAGGTTGG + Intergenic
1069378950 10:67822508-67822530 CTGAAGAGAAGAAGAGAGGCAGG + Intronic
1069552155 10:69371881-69371903 CAGATGAGAAAGTGAAAGGTTGG + Intronic
1069894670 10:71672949-71672971 CAGCTGAGAAGCAGAAAGTGGGG - Intronic
1070610312 10:77927605-77927627 CGGATGAGGAAAAGAAAGGTGGG + Intergenic
1070774325 10:79100977-79100999 CTGATGAGGAGCACAAAGGTCGG + Intronic
1071062419 10:81588473-81588495 CTGAGGGGAAACAGAAAGCTGGG + Intergenic
1071541358 10:86487413-86487435 CTGGTGAGAAAAAGAAAGATAGG - Intronic
1071901860 10:90129017-90129039 GGGATGAGAAGTAGAAAGGAAGG + Intergenic
1072660088 10:97358587-97358609 GTGATGTGAAGAAGAAAGGCCGG - Exonic
1073062652 10:100741760-100741782 GGGAAGAGAAGCAGAAAGGGAGG - Intronic
1073598990 10:104828361-104828383 CTGAGGAGAAGGAGAGAGATGGG + Intronic
1073992776 10:109282457-109282479 GGGATGAGAAGAAGAAAGATAGG - Intergenic
1074541799 10:114371289-114371311 GTGATGGAAAGGAGAAAGGTGGG + Intronic
1074607289 10:114985848-114985870 CTGAAGAGAGGGAGAGAGGTGGG + Intergenic
1075051223 10:119183689-119183711 CTGGCTAGAAGCAGAGAGGTAGG + Intergenic
1075433038 10:122405931-122405953 CTGATGAGAGACTGTAAGGTGGG - Intronic
1076418770 10:130312959-130312981 CTAGGGAGAAGCAGAAAGGAGGG + Intergenic
1077871104 11:6261965-6261987 CAGATTAGAAGCAGAGAGGATGG + Intronic
1078593442 11:12665821-12665843 CTGGTTAGAAGCAGAGAGGAGGG + Intergenic
1078789368 11:14527259-14527281 CTGATGAGAAGGAGAAAAACTGG - Intronic
1079173689 11:18119934-18119956 CTGGCTAGAAGCAGAGAGGTAGG - Intronic
1080702781 11:34658510-34658532 CTGATGAAAAGCAGAAAGGCAGG - Intronic
1081029557 11:38061512-38061534 CTGATGCTAAGCAGAAACATAGG + Intergenic
1081358884 11:42147253-42147275 CATATGAGAAGCTGAAGGGTGGG - Intergenic
1083207397 11:61161096-61161118 CTGCAGAGACGCAGAAAGGAGGG + Intronic
1083221306 11:61254564-61254586 CTGGGGACAAGCAGAAAGGCAGG + Intergenic
1083440779 11:62674921-62674943 CTGACTATAAGTAGAAAGGTTGG + Intergenic
1084685814 11:70694574-70694596 CTAATGAGCAGCAGAAACCTGGG - Intronic
1084967259 11:72751267-72751289 CTGAGGAATGGCAGAAAGGTGGG - Intronic
1085243271 11:75076008-75076030 CTGATTAGAAAGAGAAAGGAGGG - Intergenic
1085430935 11:76446954-76446976 CTGCTGAGATCCAGAAGGGTTGG - Exonic
1086562400 11:88183331-88183353 GTGATCAGAATGAGAAAGGTTGG - Intergenic
1087002074 11:93431349-93431371 GGCATGAGAACCAGAAAGGTTGG + Intronic
1088161968 11:106882926-106882948 CTGATGAGAATCTGAATGATGGG - Intronic
1088171664 11:107004708-107004730 GTGATGTGAAACAGAATGGTTGG + Intronic
1089678573 11:120106948-120106970 CTGATGAGGAGCAGGAATGGAGG - Intergenic
1090550188 11:127810893-127810915 ATGATGACAAGAATAAAGGTGGG + Intergenic
1090551294 11:127822818-127822840 CAAAAGAGAAGAAGAAAGGTTGG + Intergenic
1091168814 11:133502746-133502768 CTCCTGAGAAGCAGAATAGTGGG - Intronic
1091532437 12:1372374-1372396 CTGAAGATAAGAACAAAGGTTGG + Intronic
1091986069 12:4910906-4910928 CCGAGGAGAAGCAGAGAGGGTGG + Exonic
1094342849 12:29432073-29432095 CTGAGGAACAGCAGCAAGGTTGG + Intronic
1094637030 12:32236479-32236501 CTGAGGAGGAGGAGAAAGATGGG - Intronic
1095688122 12:45058876-45058898 TTGAGGAGAGGCAGAGAGGTGGG + Intergenic
1096618020 12:52845362-52845384 CTGAGGAAATGCAGGAAGGTCGG - Intronic
1097397884 12:59098204-59098226 TTGAAGAGAAGCAGAATGGTTGG + Intergenic
1097470891 12:59989619-59989641 CTGAAGAGAAAGAGAAAGTTAGG + Intergenic
1099300154 12:80883127-80883149 AGGATGAGAAGGAGAGAGGTAGG - Intronic
1100903336 12:99268814-99268836 CTGATGATAAAAAGAAAGGAGGG + Intronic
1101044170 12:100787429-100787451 ATGATGGCAAGAAGAAAGGTAGG + Intronic
1101891018 12:108715501-108715523 CTGGTGATAAGCAGAAAATTGGG - Intronic
1102116427 12:110406579-110406601 CAGATGAGAAGGAGAAAAATTGG + Intergenic
1102330888 12:112029248-112029270 GTGATGGGAAGAAGAAAAGTAGG + Exonic
1103058202 12:117837959-117837981 CTGATGGGATTCAGAAATGTGGG - Intronic
1104089875 12:125507418-125507440 CTGTTGAGAAACAGCAAGGAAGG + Intronic
1105241040 13:18609827-18609849 ATGATGGGAAGGTGAAAGGTGGG + Intergenic
1106489077 13:30200430-30200452 CTAATGATAAGCAGAAAGGCAGG - Intergenic
1107062059 13:36170224-36170246 CTGAGTAGAAGCAGAGGGGTGGG + Intronic
1107109219 13:36677568-36677590 CTGATGGGAAGCAGAAGGATAGG + Intronic
1107143714 13:37034074-37034096 CTGAGAAGAAGGAGAAAGATAGG - Intronic
1107374858 13:39792551-39792573 CTGAGGAGGAGGAGAAAGGGGGG + Intergenic
1108098467 13:46929601-46929623 CTGCTGTGAAGCAGAAGGGGAGG + Intergenic
1108918220 13:55642592-55642614 CTGATTAGAAGCAGTGAGGAAGG - Intergenic
1109255209 13:60071948-60071970 CTGATGGGAAGCAGAATTGGGGG - Intronic
1109515478 13:63438348-63438370 CTGAGGAGAAGGAGAGAGATAGG + Intergenic
1109621696 13:64916756-64916778 CAGAGGAGGAGGAGAAAGGTAGG - Intergenic
1110641307 13:77827912-77827934 CTGATGAGAAGAAGGGAAGTGGG + Intergenic
1113352492 13:109542969-109542991 CTGGTGAGAAGAAGAAAGGGAGG - Intergenic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115308234 14:31953821-31953843 CTGAGGAGAAGCAGAGAGTTGGG - Intergenic
1115846624 14:37542762-37542784 CTCATAAGAAGCAGTAAGGTGGG - Intronic
1115914155 14:38291636-38291658 CCGATGAGAAACAAAAAAGTGGG + Intergenic
1117075269 14:52096151-52096173 CTCAAGAGGAGCAGTAAGGTAGG - Intergenic
1117432967 14:55687862-55687884 CTTTTGAGAACCACAAAGGTAGG - Intronic
1117942918 14:60988234-60988256 TGGTTGAGAAGCAGAAATGTGGG - Intronic
1119837225 14:77761182-77761204 ATGATGAGGAGCGGAAAGGAAGG + Exonic
1119934478 14:78578617-78578639 ATGATGAGAAGCAGAAAACCTGG + Intronic
1121192938 14:92045848-92045870 CTGATGAGAAGAAGAAAAACTGG + Exonic
1121765792 14:96484287-96484309 CTGATCAGAAGTAGAGAGCTTGG - Intronic
1121836602 14:97097993-97098015 CAGCTGAGAAGCAGAGAGGCTGG + Intergenic
1123490317 15:20775318-20775340 ATGATGGGAAGGTGAAAGGTGGG - Intergenic
1123546818 15:21344405-21344427 ATGATGGGAAGGTGAAAGGTGGG - Intergenic
1125822753 15:42646944-42646966 CTGAGTAGAGGGAGAAAGGTAGG + Intronic
1126499844 15:49333544-49333566 GTGTTGTGAAGCAGAAAGCTGGG + Intronic
1128054371 15:64688861-64688883 CTGATGAGAAACACAATGGTAGG + Intronic
1128446204 15:67763420-67763442 GTTATCAGAAGGAGAAAGGTGGG - Intronic
1130304860 15:82706589-82706611 CTGATGAGAAGGAGAAAAACTGG - Intronic
1130333377 15:82938518-82938540 AGGATGAGAGGCAGTAAGGTTGG - Intronic
1130621485 15:85467356-85467378 ATGCTGTGAAGCGGAAAGGTGGG - Intronic
1131132742 15:89910530-89910552 GTGTTGAGCAGCAGACAGGTGGG - Intronic
1131518886 15:93098734-93098756 CTGATGAGAAACACAAATGGAGG - Intergenic
1131650374 15:94391830-94391852 CTGATGGCAAGTAGAAAGCTGGG + Intronic
1131756572 15:95570055-95570077 CTAAGGAGAAGGAGAAAGATGGG + Intergenic
1131967886 15:97864980-97865002 CTCATGAAAAGCAGTAAAGTTGG - Intergenic
1202955150 15_KI270727v1_random:71621-71643 ATGATGGGAAGGTGAAAGGTGGG - Intergenic
1132670028 16:1098737-1098759 CTGATGAGAAGCCGAGGGTTGGG - Intergenic
1133508998 16:6439848-6439870 CAGATGGGATGCAGAAAGCTGGG + Intronic
1133953977 16:10423748-10423770 CTGATGAGGAGGAGGAAGGAGGG - Intronic
1133959458 16:10480354-10480376 ATGGTGAGAAGAAGAAAGGAAGG - Intronic
1134086156 16:11358780-11358802 CTGAGGAGGAGAAGAAAGGAAGG + Intergenic
1134880787 16:17743802-17743824 ATGAGGAGAAGCAGACAGGGAGG + Intergenic
1135532376 16:23265667-23265689 CTGATGATAAGCAAGAAGATGGG - Intergenic
1136123265 16:28155941-28155963 CTGGTGAGGAACAGAAAGGTAGG - Intronic
1139977255 16:70823170-70823192 CTGTGGAGAAGCAGAAAAATGGG - Intronic
1140329542 16:74040591-74040613 CTGGTGGGAAGAAGAAAGGAGGG + Intergenic
1140776815 16:78256387-78256409 CTCAAGAGAAGCTGGAAGGTAGG - Intronic
1140996499 16:80264919-80264941 AAAATGAGATGCAGAAAGGTTGG + Intergenic
1143519070 17:7435487-7435509 CTTATGGGAAGCAGTAAGGGTGG - Exonic
1144110609 17:12027900-12027922 CTGGTGAGCACCAGAAAGATAGG + Intronic
1145726869 17:27137251-27137273 CTGAAGAGATGGAGAAAGATGGG - Intergenic
1147309740 17:39588253-39588275 CTCCTGAGAGGAAGAAAGGTGGG + Intergenic
1148444095 17:47727273-47727295 CTGCTGAGAGGCAGGAAGGGTGG + Intergenic
1149065591 17:52475535-52475557 CTGATTAGGAGCCTAAAGGTGGG + Intergenic
1149622682 17:58057912-58057934 CTGATGACAAGGAGAAATGGAGG - Intergenic
1149641519 17:58205954-58205976 CTGCTGAGAACCAGAAAAGCTGG - Exonic
1150465442 17:65388690-65388712 CAGATGAGAAGCAGAAATCAAGG - Intergenic
1151225011 17:72641272-72641294 ATGATGAGAAGTAGAGAGGTAGG - Intergenic
1151327039 17:73385920-73385942 GTGGAGAGAAGCAGACAGGTGGG + Intronic
1152137347 17:78512301-78512323 GTGAAGACAAGCAGAAAGGCTGG - Intronic
1153333674 18:3900301-3900323 CTGATGAGAAACAACAATGTCGG - Intronic
1153654275 18:7268830-7268852 CTGATGAGGAGCACAAAGTCAGG + Intergenic
1153881338 18:9424179-9424201 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1154447923 18:14450075-14450097 ATGATGGGAAGGTGAAAGGTGGG - Intergenic
1155066144 18:22270804-22270826 CTGAGGAAGAGCAGGAAGGTGGG + Intergenic
1155117871 18:22787433-22787455 CAGATGAGAAGTGGAAAGATGGG + Intergenic
1155207189 18:23570297-23570319 CTGATAATATGGAGAAAGGTTGG + Intronic
1155807529 18:30191162-30191184 GTGAAGAGAAACAGAAGGGTTGG - Intergenic
1156528859 18:37795749-37795771 CTGAAGAGAAGGAGAAAGCAAGG + Intergenic
1157724260 18:49951701-49951723 CAGATTAGAAGCAGAAACGAGGG - Intronic
1158576485 18:58642996-58643018 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1158678668 18:59546915-59546937 CAGATTAAAAGAAGAAAGGTAGG + Intronic
1158800402 18:60901000-60901022 CTTCTGAGAACCAGAAAGGATGG + Intergenic
1159929480 18:74296406-74296428 CTGATGAGAAGGAGAAAAACTGG - Intergenic
1162262606 19:9545040-9545062 CTGATGAGAAGGAGAAAAACTGG - Intergenic
1162424027 19:10583297-10583319 CTGATGAGATGCAGAGTGATGGG + Intronic
1163044005 19:14625641-14625663 TTGGTGAACAGCAGAAAGGTCGG + Intronic
1163679576 19:18672865-18672887 CTCATAAGAAGCAGTAAGGAAGG - Intergenic
1164578461 19:29419560-29419582 CTGAGTGGAAGCAGAAGGGTGGG - Intergenic
1166171691 19:41032162-41032184 GTGATGACAAGGATAAAGGTGGG + Intergenic
1166496166 19:43304736-43304758 CAGAAGAGAAACAGAAAGGAGGG - Intergenic
1166601966 19:44104141-44104163 TTGATGGGAATCTGAAAGGTTGG - Intronic
1166905411 19:46104970-46104992 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1167277992 19:48550407-48550429 CTGATGGTAAGCAGAAAAGGAGG - Intergenic
1167702483 19:51058294-51058316 GTGTTGAGATGCATAAAGGTTGG - Intronic
1168211805 19:54896115-54896137 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1168240294 19:55085818-55085840 CTGAGGAGAAGCGGGAGGGTTGG - Intronic
1168321676 19:55513997-55514019 CAGAGGAGAATGAGAAAGGTGGG + Intronic
1168676864 19:58284883-58284905 CTGAAGAGAAGCTGAAAATTAGG - Intronic
925613035 2:5719055-5719077 CAGATGAGCAGCAGCAAGGGAGG + Intergenic
926968287 2:18440379-18440401 CTGAAGAGGAGCAAAAAAGTGGG - Intergenic
927127481 2:20025661-20025683 CAGATCACAAGAAGAAAGGTAGG + Intergenic
927134463 2:20086645-20086667 CTGATGAGAAGGAGAAAAACTGG - Intergenic
927180784 2:20445567-20445589 CTGAACACAAGCAGGAAGGTGGG - Intergenic
927968887 2:27291529-27291551 CTGATGACAAGCATGAAGATTGG - Intronic
928096302 2:28407154-28407176 CTAATGAGAGGCAGAAAAGAAGG - Intronic
928657234 2:33464900-33464922 CTGAGGAGAGGAAGAGAGGTGGG - Intronic
928730822 2:34230058-34230080 CTGATGAGCAGCACAAAGGGAGG - Intergenic
929668321 2:43850945-43850967 CTGATGAAAAGAAGAGAGATGGG + Intronic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
930034685 2:47078120-47078142 ATGATGCGAAGGAGAAAGGAGGG - Intronic
930254000 2:49068085-49068107 GTGAGGAGATGCAGAAAGTTTGG + Intronic
930720561 2:54633686-54633708 CAGAAGAGAGGCAGAAAGGAAGG - Intronic
932285350 2:70526752-70526774 GTGATGAGAAGCAAAAAGGAGGG + Intronic
932323145 2:70836572-70836594 CTGGTGAGGAGCAGACTGGTGGG + Intergenic
932607470 2:73174979-73175001 CAGATAGGAAGCTGAAAGGTGGG + Intergenic
935131652 2:100265288-100265310 CTGGGGAGAAGGAGAAGGGTGGG - Intergenic
935637086 2:105257442-105257464 CAGATGGGAAGTAGAATGGTGGG - Intergenic
936858674 2:116990181-116990203 AGGATGAAAACCAGAAAGGTGGG + Intergenic
940724556 2:157321580-157321602 ATGATGAGGAGCAGAAGGTTTGG - Exonic
941023533 2:160436132-160436154 CTGGTGAGTACCAGAAAGGAAGG - Intronic
944231762 2:197402102-197402124 TGGATGAGCAGCAGAAAGTTCGG - Exonic
945250337 2:207760547-207760569 CTGATGAGAGGCAGGTGGGTTGG - Intronic
945291819 2:208134572-208134594 TTGCTAAGAAGCAGGAAGGTGGG - Intergenic
945487236 2:210411032-210411054 CTGATAAGAAGGAGAGAGATGGG + Intergenic
945647910 2:212523619-212523641 ATGATGAGGAGCAGATGGGTGGG + Intronic
945742912 2:213685301-213685323 CTTGTAAGAAGGAGAAAGGTGGG + Intronic
945858495 2:215094391-215094413 CTGATGAGAAGCAGAAAAACTGG - Intronic
946843236 2:223837759-223837781 CAGAGGAGAGGCAGAAAGGAGGG - Intronic
947523902 2:230866973-230866995 CTGATGAGAAGCCAGAAGCTAGG - Intronic
947598772 2:231431546-231431568 CTGATGAGAAGGAGAAAAACTGG + Intergenic
947642437 2:231714535-231714557 CTGGTGTGAAACACAAAGGTCGG - Intergenic
948074291 2:235153705-235153727 ATGATGCAAAGCAGAAAGGATGG - Intergenic
1169408255 20:5344280-5344302 CTGATGAGATGTGGAAAGGGGGG - Intergenic
1169889572 20:10437628-10437650 GGGAGGAGAAGCAGAAAGGCTGG - Intronic
1170033823 20:11969655-11969677 CTGAGGTCAAGCAGCAAGGTGGG - Intergenic
1170155438 20:13264876-13264898 CTGATGAGAATGAGGAAGGAGGG + Intronic
1170358722 20:15520957-15520979 CTGATGAGAAACAGAATGAAAGG - Intronic
1170469130 20:16650765-16650787 CTGTTGAAAACCAGAAATGTGGG - Intergenic
1171385314 20:24765862-24765884 CTGTTGACAAGCAGAGAAGTAGG + Intergenic
1172128341 20:32638804-32638826 CTGGAGAGAAGCAGAAAGGGGGG + Intergenic
1173120875 20:40287728-40287750 CTAATGAGAAATGGAAAGGTGGG - Intergenic
1173126252 20:40338870-40338892 CTGTTTAGAAACAGAAAGCTGGG - Intergenic
1174393364 20:50231723-50231745 CTGGTGGGGAGCAGACAGGTGGG + Intergenic
1174707189 20:52669072-52669094 ATGCTCAGAAGCACAAAGGTTGG - Intergenic
1175307469 20:57986829-57986851 CTTAGGAGAAGCAGAGAGCTGGG + Intergenic
1176255731 20:64151884-64151906 CTGATGAGGACCAGAAACGCGGG - Intronic
1176448294 21:6840601-6840623 ATGATGGGAAGGTGAAAGGTGGG + Intergenic
1176826464 21:13705623-13705645 ATGATGGGAAGGTGAAAGGTGGG + Intergenic
1177608807 21:23419120-23419142 CTGAGGAGCAGCAAAAAGTTGGG - Intergenic
1178100537 21:29264054-29264076 CTGAAGAGAGGGAGAGAGGTGGG + Intronic
1178471591 21:32898464-32898486 CTGAAGAGAAGCTAAAAGATTGG + Intergenic
1178806476 21:35843975-35843997 CTGATGAGAATCAAGAAGGCCGG + Intronic
1179381262 21:40901478-40901500 CAGGTGAGAAACAGAAGGGTTGG + Intergenic
1179767924 21:43587814-43587836 CTGATGAGTGGCAGAAACTTGGG + Intronic
1180631203 22:17231275-17231297 GAGATGAGAAACAGAAAGATGGG - Intergenic
1181882216 22:25990068-25990090 CTGATGAGAGGGAGAAGGGGTGG - Intronic
1181978909 22:26752378-26752400 CTGCTGAGATGCAGGAAGGTGGG + Intergenic
1182582923 22:31325925-31325947 CTGTTGGGAACCAGGAAGGTGGG - Exonic
1183090888 22:35521046-35521068 TTGCTGAGAAGCAGTAAGCTAGG + Intergenic
1183126491 22:35786880-35786902 CTAATGAGAAGAAGAGAGGATGG - Intronic
1183635284 22:39058383-39058405 CTGATGAGAAGGAGAAAAACCGG + Intronic
1185114278 22:48922514-48922536 CTGAAGAGGGGAAGAAAGGTAGG + Intergenic
1185239432 22:49734757-49734779 CTGAAGAGCAGCACAAAGGAAGG + Intergenic
950168619 3:10820417-10820439 CTGCTGTCAAGCAGGAAGGTGGG - Intronic
950951625 3:17006174-17006196 CTGGTCAGAAGCAGAGAGCTGGG - Intronic
952297249 3:32072380-32072402 CTGATGAGAAGGAGAAAAACTGG - Intronic
952671886 3:35978681-35978703 GTGAGGAGAAGCAGAAGGGAGGG - Intergenic
952765834 3:36953330-36953352 CATGTGAGAAGCAGAAAGATAGG - Intergenic
953834120 3:46328400-46328422 CTGATGAGAAGGAGAAAAACTGG + Intergenic
954881735 3:53840754-53840776 GTGAAGGAAAGCAGAAAGGTGGG + Intronic
955153557 3:56393053-56393075 CTGATGAGATGGGGAAGGGTGGG - Intronic
955706936 3:61737517-61737539 CTGACCAGAAGCACAAAGCTTGG + Intronic
955946799 3:64203136-64203158 TTGATGAGAAGCAGAAAGTGGGG - Intronic
956030018 3:65027572-65027594 ACGGTGAGAAGCAGTAAGGTAGG - Intergenic
956233205 3:67040066-67040088 CTGATGAGAAGGAGAAAAACTGG + Intergenic
956932415 3:74059923-74059945 CAGAAGAGAAGGGGAAAGGTGGG + Intergenic
957451762 3:80389291-80389313 CTGATGAGAAGGAGAAAAATTGG - Intergenic
957957057 3:87201220-87201242 CTGATGAAAATCAAAAAGATTGG - Intergenic
958112150 3:89162524-89162546 TTGAGGAGAAGGAGAGAGGTTGG - Intronic
958121633 3:89297404-89297426 CAGAGGAGAAGCAGAGAGATAGG + Intronic
959531069 3:107434007-107434029 TTGATGAGAGGCAGAATTGTGGG - Intergenic
959988375 3:112602270-112602292 CTGAGAAGAAGGAGAAAGATTGG - Intergenic
961459995 3:127044095-127044117 CTGATGGGACTGAGAAAGGTGGG + Intergenic
965624017 3:170668987-170669009 CTGATGAGGACCAGCAAGCTTGG + Intronic
966998467 3:185308759-185308781 CTGATGAGAAGATGCAAGTTTGG + Intronic
967106971 3:186261868-186261890 CAGATGAGAAGCAGGAGGGCAGG + Intronic
969864353 4:10064077-10064099 CTCATGGAAACCAGAAAGGTAGG + Intergenic
969926956 4:10594105-10594127 CTGGTGGGAAGCAGAAGAGTGGG - Intronic
970354458 4:15238214-15238236 CTGATGAAAAACAAAAAGGCTGG - Intergenic
971750984 4:30647637-30647659 CTCATGAGATACAGATAGGTAGG + Intergenic
971767161 4:30847364-30847386 CTGGTGTGAAGCACAAAGGGAGG - Intronic
972691973 4:41407725-41407747 ATGATGAGAAGCAGGCAGGAAGG - Intronic
973106034 4:46338859-46338881 CTACTGAGAAGTAGAAAGGTTGG + Intronic
974031316 4:56779265-56779287 CTGATTAGAAGGATATAGGTAGG - Intergenic
974173109 4:58292610-58292632 CTGATGAGAAGGAGAAAAATTGG + Intergenic
974460590 4:62182428-62182450 CTGCAGAGAAGCAGAAAATTGGG - Intergenic
974859314 4:67499936-67499958 CTGAAGAGAGGGAGAAAGATGGG + Intronic
975578769 4:75888498-75888520 ATGATGAGAAGCAGAAACAAGGG - Intronic
976231848 4:82852488-82852510 CTTAGGAAAGGCAGAAAGGTAGG - Intronic
976739584 4:88344667-88344689 CTGATGAGAAGGAGAAAAACTGG + Intergenic
977900941 4:102421801-102421823 CTGATAAGAACCAAAAAGGAGGG + Intronic
980465832 4:133179424-133179446 ATGATGTGAAACAGAAATGTAGG - Intronic
981039396 4:140209567-140209589 CTGATAAGAAGCAGATGGTTAGG + Intergenic
981194987 4:141908904-141908926 TTTATGAGAAGCAGAAAGAAGGG + Intergenic
981438358 4:144752876-144752898 CTGGTGGGAAGAAGAAAGGGAGG + Intergenic
982044807 4:151433364-151433386 CTGATGAGATGTGGAAAGTTAGG + Intronic
982398421 4:154939011-154939033 CTTCTGCTAAGCAGAAAGGTGGG + Intergenic
984383136 4:179020469-179020491 CTGAAAAGAAGCAGGAAGCTTGG - Intergenic
985250253 4:188016771-188016793 CAGATGTGAAGCAGAAAAGAGGG + Intergenic
987271664 5:16315279-16315301 CAGATGAGAAACAGAAATGATGG - Intergenic
987626226 5:20404535-20404557 CTGATGAGAGGGAGAGAGATAGG + Intronic
989306713 5:39966329-39966351 TGGAGGAGAGGCAGAAAGGTGGG - Intergenic
989614834 5:43329227-43329249 CTGATGAGAAGGAGAAAAGCTGG + Intergenic
990057074 5:51595587-51595609 CCTATGTGAAGTAGAAAGGTGGG - Intergenic
990886636 5:60601907-60601929 CAGATGAGAAAAAGAAATGTTGG + Intronic
991553656 5:67871293-67871315 ATGCTAAGAAGTAGAAAGGTGGG + Intergenic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
995084173 5:108088419-108088441 CAGAGGAGAAGCAGAAAAATGGG - Intronic
997274832 5:132576334-132576356 GAGATGAGAAGCAGACAAGTAGG + Intronic
998484204 5:142487401-142487423 GTGATGAGAAGGAGAGCGGTAGG + Intergenic
998998259 5:147890789-147890811 CTAATGAGTAGGAGAAAGGAAGG + Intronic
999125002 5:149240090-149240112 CTGAGAAGCAGCAGGAAGGTGGG + Intronic
999285992 5:150394614-150394636 CAGATAAGCAGCAGAAAAGTGGG + Intronic
1000040064 5:157478903-157478925 CTGATGTGAGGGAGAAAGGCTGG + Exonic
1000199997 5:158998721-158998743 CTGAAGGGAAGCACAAAAGTAGG + Intronic
1000334049 5:160228884-160228906 GTGTAGAGAAGCAGGAAGGTTGG - Intronic
1001153648 5:169254188-169254210 ATGATGAGAAACACAAAGCTGGG + Intronic
1002052346 5:176578144-176578166 CTGCAGAGAGGCAGAGAGGTGGG - Intronic
1002857021 6:1046950-1046972 CTGATGGGGAGAAGAAAGGATGG + Intergenic
1003237636 6:4311295-4311317 CTGATTTGCAGCAGAGAGGTGGG - Intergenic
1003688529 6:8328403-8328425 CAGATGCAAAGCAGAAAGGATGG - Intergenic
1004152843 6:13136771-13136793 CTGAGGAGAGGGAGAAAGATAGG + Intronic
1004987850 6:21102856-21102878 CTGGCAGGAAGCAGAAAGGTAGG - Intronic
1006335638 6:33419071-33419093 CCAATGAGAGGCAGAGAGGTGGG + Intergenic
1006613415 6:35309580-35309602 GTGAGGACAAGCAGAGAGGTGGG + Intronic
1007309508 6:40934390-40934412 CTCATGAGAAGAAGAAAGGCAGG - Intergenic
1007515701 6:42409590-42409612 CTGATCAGAAGCAGCCATGTAGG + Intronic
1008148851 6:47925645-47925667 GTGATGACAACCACAAAGGTGGG + Intronic
1008694132 6:54014388-54014410 CTTCTGGGAAGCAAAAAGGTTGG - Intronic
1009749944 6:67869947-67869969 CTGATGAGAAGGAGAGAAATTGG + Intergenic
1009754370 6:67917454-67917476 ATGATGAGAATTAGAAAGGCTGG - Intergenic
1010050055 6:71493083-71493105 CTGAGGAGAGGCAGAGAGATGGG - Intergenic
1010497654 6:76554736-76554758 CTGCTATGAAGCAGAAATGTGGG - Intergenic
1010761158 6:79724834-79724856 AGGATGAGAAGCAGAAATGGTGG - Intergenic
1012284463 6:97372169-97372191 CTGAAGAGAAGGAGAGAGATGGG - Intergenic
1012549450 6:100454011-100454033 CTGCTGAGAAGCTGACAGGACGG - Intronic
1013266468 6:108504386-108504408 CTGAAGAGAGGGAGAAAGATGGG + Intronic
1013807731 6:114013400-114013422 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1015399542 6:132773359-132773381 CTGGTGAGAAGAAGCCAGGTTGG - Intronic
1016344176 6:143093794-143093816 CTGAAGAGAAGGAGAAAAATGGG + Intronic
1016648554 6:146438005-146438027 CAGAAGAGTAGCAGTAAGGTTGG - Intergenic
1017270163 6:152494902-152494924 CTGATGAGAAGGAGAAAAACTGG - Intronic
1018339526 6:162836533-162836555 CTTTTGAGTAGCAGAAAGGACGG - Intronic
1019580380 7:1758995-1759017 CTGATGAGAGACAGAAGGCTGGG - Intergenic
1019812816 7:3176927-3176949 CTTATGAGAAGAAGAAAATTTGG + Intergenic
1021107527 7:16655021-16655043 CTGAACAGAAGCAAAAAAGTAGG - Intronic
1022215990 7:28261968-28261990 CTGAGGAGGAGAAGAAAGGCTGG - Intergenic
1022497681 7:30863271-30863293 CTGGAGAGAAGCAGAGTGGTGGG + Intronic
1023662349 7:42482859-42482881 CTGATGAGAAGCGAAGAGGGAGG - Intergenic
1024738905 7:52334772-52334794 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1027888292 7:83937664-83937686 CAGATGAAAAGCAGAAATGCAGG + Intergenic
1028947980 7:96602350-96602372 CTGATGCCATGCAGAAATGTGGG - Intronic
1029144767 7:98438017-98438039 CTGATGACAAGCTGAGAGGAAGG + Intergenic
1029317538 7:99728067-99728089 CTGATGAGAAGGAGAAAAACTGG - Intronic
1029361351 7:100090532-100090554 ATGAGGGGAAGGAGAAAGGTAGG + Intronic
1029415805 7:100442429-100442451 CTGCTGGGATGCAGAAAAGTTGG + Intergenic
1030445550 7:109643915-109643937 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1031922455 7:127612060-127612082 GTGGTGAGAGGCAGGAAGGTTGG + Intronic
1032696933 7:134345183-134345205 CTTATGAAAAGTAGAGAGGTGGG + Intergenic
1033486052 7:141790195-141790217 GTGATGAGGAACAGAGAGGTTGG - Exonic
1034278571 7:149835926-149835948 CTGTTTAGAAGCAGAAAGTTGGG - Intergenic
1034296888 7:149981604-149981626 CTGATGAGTGGCAGAAGGGGGGG + Intergenic
1036417506 8:8564266-8564288 ATGATCAGAAGTGGAAAGGTGGG + Intergenic
1036594592 8:10200501-10200523 GTGATGAGGAGCAGCAAGGCAGG - Intronic
1036923360 8:12879634-12879656 CTGAGATGAAACAGAAAGGTAGG + Intergenic
1038272210 8:26084460-26084482 CTTAAGAGAAACAGAAAGGAGGG + Intergenic
1038304369 8:26385162-26385184 CTAAAAAGAAACAGAAAGGTTGG - Intronic
1038373609 8:27015839-27015861 CTGAGGAGAAACAGAAGGGGTGG + Intergenic
1038861840 8:31396372-31396394 CAAATGAGAAGAAGAAAGCTTGG + Intergenic
1040380610 8:46868400-46868422 CAGAAGACAAGCAAAAAGGTGGG + Intergenic
1040851405 8:51904489-51904511 CAGATTAGGAGAAGAAAGGTGGG - Intergenic
1040932230 8:52747332-52747354 CTTATGACAAGCCGAATGGTTGG + Intergenic
1040974793 8:53178060-53178082 CTGAAGAAAAGCAGAGATGTGGG + Intergenic
1041651498 8:60307568-60307590 CTGATGAGAAGGAGAAAAATTGG + Intergenic
1041872488 8:62650665-62650687 CTGGTGATAATCAGAAATGTAGG - Intronic
1042419419 8:68568028-68568050 CTGAGAAGAAGCAGAGAGATAGG + Intronic
1042878480 8:73461872-73461894 CTGCTGAGAACCAGACAGCTGGG - Intronic
1042941156 8:74109513-74109535 GTCATGGGAAGAAGAAAGGTAGG + Intergenic
1043597141 8:81899848-81899870 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1043790462 8:84460681-84460703 CTGATGAGAAGTTGGAGGGTCGG + Intronic
1044469331 8:92547831-92547853 ATGATAAGAAGAAGAAAGGCAGG - Intergenic
1044694755 8:94911680-94911702 CAGCTGAGAAGCAGGAAGGAAGG + Intronic
1044736685 8:95286074-95286096 ATGATGAGCAGCACAAAGGAAGG + Intergenic
1046549521 8:115696762-115696784 CAGATGAGAAGAAATAAGGTAGG - Intronic
1047492007 8:125382819-125382841 CTGTTGATAAGCAGAAAGGGTGG + Intergenic
1047806182 8:128362597-128362619 CTGATGAGGGGGAGAATGGTAGG - Intergenic
1048532897 8:135266418-135266440 TGGATGTGAAGCAGACAGGTGGG - Intergenic
1049404438 8:142445468-142445490 TTGATGGGAAACAGAAAGGGGGG - Intergenic
1049697708 8:143991672-143991694 GTGCTGAGAAGCAGACAGGCTGG - Exonic
1050566298 9:6887475-6887497 CAGAAAAGAAACAGAAAGGTGGG + Intronic
1052223800 9:26059830-26059852 TTGATTTGAACCAGAAAGGTAGG + Intergenic
1054881827 9:70152054-70152076 CTGGAGAGAAGCTGAAAGGCTGG - Intronic
1056212272 9:84375848-84375870 CTGGTGAAAAACAGAAAGGCTGG + Intergenic
1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG + Intergenic
1057909413 9:99005971-99005993 CTGCTGAGAGGCAGAGAGGACGG - Intronic
1057948592 9:99351815-99351837 CTGGAGAGGAACAGAAAGGTTGG + Intergenic
1058561295 9:106231986-106232008 CATATGAGAAGCAGACAGGAAGG - Intergenic
1059440340 9:114303064-114303086 CTGATGAGAAGGACAAGGGAAGG - Intronic
1059751687 9:117253595-117253617 GTGATGAGAATAAGAATGGTGGG - Intronic
1060438532 9:123617091-123617113 CTGGTGAGAAGTAGAAAGTATGG + Intronic
1061613794 9:131765980-131766002 TTGAAGAGGAGCTGAAAGGTGGG - Intergenic
1203520897 Un_GL000213v1:43917-43939 ATGATGGGAAGGTGAAAGGTGGG - Intergenic
1185528728 X:800181-800203 CTGTTGAGAAGTAGAATGGCTGG + Intergenic
1186463478 X:9766088-9766110 GGAAGGAGAAGCAGAAAGGTTGG + Intronic
1186626391 X:11298525-11298547 CTGGTGAGAAACAGAGAGGCAGG - Intronic
1187180764 X:16941649-16941671 CTGAGTACAACCAGAAAGGTAGG + Intergenic
1187341989 X:18429601-18429623 CTAAAGAGAAGCAGAAAGCATGG - Intronic
1188291446 X:28393611-28393633 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1190982416 X:55468000-55468022 TAGATGAGAAGCATCAAGGTGGG + Intergenic
1190986283 X:55505183-55505205 TAGATGAGAAGCATCAAGGTGGG - Intergenic
1192163277 X:68804667-68804689 CTGATGAGATGCAGTAAGGTTGG + Intergenic
1194089733 X:89569858-89569880 GTGCTGATATGCAGAAAGGTTGG - Intergenic
1194246974 X:91526148-91526170 TTCATGAGAAGGAGACAGGTAGG - Intergenic
1194673627 X:96766794-96766816 TTGATTAGAAGCAGAAATGGAGG + Intronic
1196862291 X:120039716-120039738 CTGAGGAGGAGGAGCAAGGTGGG - Intergenic
1196880811 X:120196628-120196650 CTGAGGAGGAGGAGCAAGGTGGG + Intergenic
1198281417 X:135146520-135146542 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1198289542 X:135225996-135226018 CTGAGGAGAAGGAGAGAGATGGG - Intergenic
1199558511 X:149136613-149136635 CTGATGAGATCCATACAGGTTGG - Intergenic
1199699778 X:150366443-150366465 CAGAAGAGAAGCACAAAGGAGGG - Intronic
1199852886 X:151737922-151737944 GTGAGGAGAACCAGAAAGCTGGG - Intergenic
1200226741 X:154421628-154421650 ATGTTGAGAGGCAGAAAGGATGG - Exonic
1200442385 Y:3225911-3225933 GTGCTGATATGCAGAAAGGTTGG - Intergenic
1200565939 Y:4767436-4767458 TTCATGAGAAGGAGACAGGTAGG - Intergenic
1201367431 Y:13223477-13223499 CATAGGAGAATCAGAAAGGTGGG + Intergenic
1202266185 Y:23021554-23021576 CAGAAGAGAAGCAAAGAGGTGGG - Intergenic
1202419178 Y:24655297-24655319 CAGAAGAGAAGCAAAGAGGTGGG - Intergenic
1202451608 Y:25014787-25014809 CAGAAGAGAAGCAAAGAGGTGGG + Intergenic