ID: 907040168

View in Genome Browser
Species Human (GRCh38)
Location 1:51251781-51251803
Sequence CAAAAGAATTAGCTGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 441}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907040164_907040168 15 Left 907040164 1:51251743-51251765 CCTGGGCAGGAGAGCAAGACCTC 0: 1
1: 13
2: 364
3: 4765
4: 30133
Right 907040168 1:51251781-51251803 CAAAAGAATTAGCTGGAGCCGGG 0: 1
1: 0
2: 4
3: 70
4: 441
907040165_907040168 -4 Left 907040165 1:51251762-51251784 CCTCATCTTTACAAAAAATCAAA 0: 5
1: 212
2: 3352
3: 21513
4: 141590
Right 907040168 1:51251781-51251803 CAAAAGAATTAGCTGGAGCCGGG 0: 1
1: 0
2: 4
3: 70
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907040168 Original CRISPR CAAAAGAATTAGCTGGAGCC GGG Intronic
900211521 1:1458573-1458595 CAAAAAAGTTAGCTGGGGCCTGG - Intronic
900305994 1:2008529-2008551 TAAAAAAATTATCTGGAGCCGGG + Intergenic
901074370 1:6543827-6543849 CAAAAAAATTAGCCAGAGGCCGG + Intronic
901427310 1:9190658-9190680 CAAAAGAATGATCATGAGCCAGG - Intergenic
901467754 1:9433605-9433627 GGAAAGAAGTAGCTGGAGCAGGG + Intergenic
901495099 1:9616420-9616442 CAAGAAAATTAGCTGGGGCCGGG + Intergenic
901868134 1:12121206-12121228 TACCTGAATTAGCTGGAGCCTGG - Intronic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902293248 1:15448639-15448661 CAAAAAAATTAGCTGGGGCCGGG - Intronic
902324646 1:15691795-15691817 CAAAAAAATTAGCTGGGGGCGGG + Intronic
902418886 1:16261857-16261879 AAAAAAAATTAGCTTGAGCATGG - Intronic
902502444 1:16920045-16920067 AAAAAAAATTAGCTGGGGCGTGG - Intronic
902693113 1:18122774-18122796 AAAAAAAATTAGCTGGGGCGTGG - Intronic
902882684 1:19383148-19383170 CAAAAAAATTAGCTGGGGCTGGG + Intronic
902929434 1:19720296-19720318 TGAAAGAATTAAGTGGAGCCAGG - Intronic
903177270 1:21588605-21588627 CAGGAGAATTGCCTGGAGCCGGG + Intergenic
903436817 1:23356039-23356061 CACAAGAATCAGCTTGAACCTGG + Intergenic
903785272 1:25857021-25857043 CAAGAGGATCACCTGGAGCCCGG + Intronic
903830932 1:26174086-26174108 CAAAAGACAAAGCTGGAGACGGG + Intergenic
903924515 1:26822248-26822270 AAAAAGAATTATTTGCAGCCTGG - Intergenic
903941177 1:26932473-26932495 CAGAAAAATTAGCTGGGGGCCGG - Intronic
903987428 1:27238858-27238880 CAAAAAAATTAGCCGGGGCTGGG - Intronic
904122316 1:28207901-28207923 CAAAAAAATTAGCCAGAGGCCGG + Intronic
904174897 1:28620224-28620246 CAAAAGAATCACCTGAACCCGGG - Intronic
904175518 1:28625834-28625856 AAAAAAAATTAGCTGGGGCCAGG - Intronic
904204564 1:28845186-28845208 TACAAAAATTAGCTGGGGCCAGG + Intronic
904230570 1:29067200-29067222 CAAAAAAATTAGCCGGGGCCAGG + Intronic
904685780 1:32259317-32259339 AAAAAAAAATAGCTGGAGGCTGG + Intronic
904737217 1:32643788-32643810 AAAAAAAATTAGCTGGGGCCAGG - Intronic
906993381 1:50763100-50763122 CAAAAAAATTAGCTGGGGCATGG + Intronic
907040168 1:51251781-51251803 CAAAAGAATTAGCTGGAGCCGGG + Intronic
908216646 1:61960568-61960590 CAGAAGAATCAGCTTGAACCAGG + Intronic
909519004 1:76545809-76545831 CAAAAAAATTAGCTGGATGTGGG - Intronic
910191882 1:84603592-84603614 CCAAAGATTTAGTTGGAACCAGG - Intergenic
910677360 1:89828032-89828054 CATTAGAATTACCTGGAGGCAGG - Intronic
910970702 1:92852885-92852907 CAAAAGAATTAGCTGGGTTTGGG + Intronic
911304660 1:96218239-96218261 CTAAAGCATTAACTGGACCCAGG + Intergenic
912182808 1:107238478-107238500 CATAAGAATTGGGAGGAGCCAGG + Intronic
912348383 1:108987761-108987783 AAAAACAATTGGCTGGAACCAGG - Intronic
912396988 1:109353171-109353193 CAAAAAAATTAGCTGGGCCTGGG + Intronic
913155786 1:116096755-116096777 AAAAAAAATTAGCTGGACTCTGG - Intergenic
914449815 1:147781137-147781159 CAAATGAAGGCGCTGGAGCCAGG - Intergenic
915150233 1:153824929-153824951 CAAAACAATTAGCTGGGTACAGG + Intronic
918178788 1:182068618-182068640 CATAAGAATAATCTGGGGCCAGG + Intergenic
919078001 1:192835989-192836011 CAAAAGAAATAGCTGGATGCTGG + Intergenic
919364963 1:196648325-196648347 CACAAGACATTGCTGGAGCCAGG - Intergenic
919631246 1:199961962-199961984 CAAGAGAATTACTTGCAGCCGGG + Intergenic
920397239 1:205656093-205656115 CACAAGAATTTGCTTGAACCTGG + Intergenic
921014963 1:211181126-211181148 CATAAGAATTAGCTCCTGCCTGG + Intergenic
921402513 1:214741505-214741527 CAAAAAAATTAGCTGGGACCAGG - Intergenic
922295467 1:224246121-224246143 CAGGAGAATTAGCTTGAACCCGG - Intronic
922423440 1:225474199-225474221 CAAAAGATTTATTGGGAGCCAGG - Intergenic
924353760 1:243147736-243147758 CAAAAAAATTAACTGTAGCTAGG + Intronic
1063163487 10:3438490-3438512 CAAAAAAATTAGCTCGGGCATGG - Intergenic
1063408119 10:5815482-5815504 AAAAAAAATTAGCTGGAGGCCGG + Intronic
1064426213 10:15231935-15231957 CAAAAAAATTAGCTGGGCCGTGG + Intronic
1064427119 10:15239455-15239477 TACAAAAATTAGCTGGAGCCGGG - Intronic
1064746238 10:18481337-18481359 CAAAAGAATCACTTGAAGCCAGG - Intronic
1064844407 10:19635121-19635143 CAAAAGACTTAACTGGAGAATGG + Intronic
1065086056 10:22178196-22178218 AAGAAGAAATAGCTGGGGCCAGG + Intergenic
1065513821 10:26505638-26505660 CAAAATCATTAGCTGAGGCCAGG - Intronic
1067394993 10:45906990-45907012 CTACAGAAGTAGCTGGAGGCTGG - Intergenic
1067863313 10:49876121-49876143 CTACAGAAGTAGCTGGAGGCTGG - Intronic
1068070710 10:52191316-52191338 AAAAAAAAATAGCTGGAGCATGG - Intronic
1068502796 10:57861497-57861519 CAAAAAAATTATCTGAAGCTTGG + Intergenic
1069473366 10:68712304-68712326 CAAGAGAATTACCTGAACCCCGG + Intergenic
1070125511 10:73618445-73618467 GTAAAAAATTAGCTGGGGCCGGG + Intronic
1070471201 10:76781404-76781426 GAAAAGAAGAAGCTGGAGGCCGG - Intergenic
1070790529 10:79186694-79186716 CAAAAGAATGAGCGTGAGCAGGG + Intronic
1071784830 10:88887501-88887523 CAAAAGGTTTGGGTGGAGCCTGG + Intronic
1071942297 10:90603376-90603398 AAAAAGAGTTAGCAGGAGACTGG - Intergenic
1072140811 10:92587708-92587730 CAAACAAATTAGCTGGGGCCGGG - Intergenic
1072434469 10:95402759-95402781 ACAAAAAATTAGCTGGGGCCAGG - Intronic
1072457132 10:95586599-95586621 AAAAAAAATTAGCTGGGGCAGGG - Intergenic
1072582117 10:96748604-96748626 AAAATAAATTAGCTGGAGCCAGG + Intergenic
1072813848 10:98485746-98485768 CAAAAGAATTTACTGCAGTCTGG - Intronic
1073413112 10:103358906-103358928 CAGAAGAATTGCTTGGAGCCAGG + Intergenic
1074397452 10:113109481-113109503 CAAAAGAATTACTTGAACCCAGG - Intronic
1074716878 10:116228074-116228096 CAAAAGAACTGGCTGGAACATGG + Intronic
1075655157 10:124156416-124156438 GAGAAGAAAAAGCTGGAGCCAGG + Intergenic
1075742714 10:124705628-124705650 GAACAGGATGAGCTGGAGCCAGG - Intronic
1075790934 10:125084074-125084096 CAAAAAACGTAGCTGGGGCCAGG - Intronic
1077635291 11:3837982-3838004 CAAAAGAGGAAGCTGGACCCTGG + Intronic
1078705803 11:13742500-13742522 AAAAACAATTAACTGCAGCCTGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079403432 11:20125196-20125218 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
1080200120 11:29659373-29659395 ACAAAAAATTAGCTGGGGCCTGG - Intergenic
1081877866 11:46422571-46422593 GAAAAGAATGAGAGGGAGCCAGG + Intronic
1081961213 11:47138884-47138906 CAAGAGAATTCGCTTGAACCTGG + Intronic
1083043238 11:59708427-59708449 TAAAAAAATTATCTGGAGCATGG - Intergenic
1083374978 11:62212540-62212562 CAGAAGAATTACTTGAAGCCAGG + Intronic
1083939358 11:65887351-65887373 CACAAGAATTACCTGAACCCAGG + Intronic
1084081525 11:66829088-66829110 AAAAAAAATTAGCTGAGGCCGGG + Intronic
1085170040 11:74442072-74442094 CAAAAGTGTGAGATGGAGCCAGG + Intergenic
1087148586 11:94837154-94837176 CAAGACAATTTGCTGGAGCCTGG - Intronic
1088664320 11:112079236-112079258 CAGAAGAATTGGCTGAATCCAGG - Intronic
1088981931 11:114871795-114871817 CAGAACAATGAGCTGGGGCCGGG + Intergenic
1089490384 11:118879779-118879801 AAAAAGAATTACCTTGTGCCTGG - Intergenic
1089568096 11:119383024-119383046 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1089928195 11:122281242-122281264 GGAAAGAAATAGCAGGAGCCGGG + Intergenic
1091791981 12:3277196-3277218 CACCAGGATAAGCTGGAGCCGGG + Intronic
1092221209 12:6715233-6715255 CAAATAAATTAGCTTGAACCTGG - Intergenic
1092463429 12:8706603-8706625 CAAAAAAATTAGCCGGACGCAGG - Intronic
1093980744 12:25472591-25472613 CAAAAGAACTCACAGGAGCCAGG + Intronic
1095358775 12:41310023-41310045 CAAAAGAATCACTTGAAGCCAGG - Intronic
1096118864 12:49073305-49073327 ATAAAAAATTAGCTGGGGCCGGG + Intergenic
1096126285 12:49122203-49122225 CAAAACAATTAGCCGGGGCGTGG + Intergenic
1096152213 12:49321823-49321845 CACAAAAATTAGCTGGTGGCAGG + Intergenic
1096637124 12:52967241-52967263 CAAAAGAATCACCTGAACCCGGG + Intergenic
1096836894 12:54356903-54356925 CAAAAGAATTGGGTGGAGGGGGG + Intergenic
1097023891 12:56039912-56039934 TACAAAAATTAGCTGGGGCCGGG + Intergenic
1098269090 12:68752848-68752870 CAAAAAAATTAGCTGAGGCTGGG + Intronic
1098896934 12:76073701-76073723 GAAAAGAATTAGCAAAAGCCAGG + Intronic
1100005487 12:89890525-89890547 CTAAGGAATTAGCAGGAGTCAGG + Intergenic
1100262095 12:92942042-92942064 CAAGAGAATCAGTTGAAGCCAGG - Intergenic
1100546292 12:95605805-95605827 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
1100956298 12:99912645-99912667 TAAAAAAATTAACTGGGGCCAGG - Intronic
1101014091 12:100481618-100481640 TAAAAAAATTAGCTGGGGCTGGG + Intronic
1101903521 12:108808924-108808946 CAAGAGAATTAGTTGAACCCAGG - Intronic
1102118112 12:110419123-110419145 CACAAAAATTAGCAGGAGCATGG - Intergenic
1102325855 12:111983140-111983162 AAAAAAAATTAGCTGGGGCCAGG + Intronic
1102333922 12:112060692-112060714 CTAAAGAATTAGATGAAGTCAGG - Intronic
1102473775 12:113175490-113175512 ATAAAAAATTAGCTGGGGCCGGG + Intronic
1102778163 12:115539172-115539194 CAAAAGATCTCACTGGAGCCAGG + Intergenic
1103072711 12:117957983-117958005 CAAAAAAATTAGCTGGTGTGGGG - Intronic
1103624908 12:122210882-122210904 TAAAAAAATTAGCTGGGGCATGG + Intronic
1103822746 12:123711889-123711911 CAAAAAAATTAGCTGGACGCGGG + Intergenic
1105588189 13:21764092-21764114 CAAAAAAATTAGCCGGGGCCGGG - Intergenic
1105791574 13:23805445-23805467 CAAAGGAATTAGATAGAGTCTGG + Intronic
1106384917 13:29274883-29274905 AAAAAAAATTAGCTGGGGCATGG - Intronic
1107909131 13:45088814-45088836 TAAAAAAATTAGCTGGGGCTGGG - Intergenic
1107956788 13:45521893-45521915 CAAAAGAATTGCTTGGACCCGGG - Intronic
1108552326 13:51558985-51559007 CAGAAGAAGTATCTGGAGACAGG - Intergenic
1108905650 13:55468794-55468816 CAAAAAAATTAGCCGGGGCTGGG + Intergenic
1110712345 13:78664042-78664064 CCAAAGATTTAGTTGGGGCCAGG + Intergenic
1112486407 13:99824267-99824289 CAAAAGGATTAGCTGGGGGTGGG - Intronic
1112793307 13:103027840-103027862 CAACAGACCCAGCTGGAGCCTGG - Intergenic
1114184342 14:20388852-20388874 AAAAAGAAGTAACTGGAGCCGGG + Intronic
1115226713 14:31110736-31110758 CATAAGAATTTGCTTGAACCCGG - Intronic
1115348847 14:32371450-32371472 CAAAAGAATTAGCTGGGCGTGGG + Intronic
1116295846 14:43107664-43107686 AAAAAAAATTAGCTGGGGCATGG + Intergenic
1116599111 14:46895631-46895653 CAGGAGAATTAGCTTGAACCTGG + Intronic
1118834089 14:69463783-69463805 AAAAAAAATTAGCTGGGGCCAGG + Intergenic
1119376701 14:74200119-74200141 CAAAAGAATATCCTGGGGCCGGG + Exonic
1119398264 14:74344577-74344599 CAAAAAAATTAGCAGGGGCGTGG + Intronic
1119425235 14:74530808-74530830 AAAAAGAATTCGCTGGGGCTGGG - Intronic
1119458132 14:74774386-74774408 CAAAAAAATTAGCTGGGCCATGG - Intronic
1119512628 14:75223391-75223413 ATAAAAAATTAGCTGGGGCCAGG - Intergenic
1119652207 14:76391935-76391957 CCAATGAATGAGTTGGAGCCTGG - Intronic
1120245394 14:81999757-81999779 CAAAATAATTAGTTGCAGCTCGG - Intergenic
1121048354 14:90804038-90804060 CAAAAGAAAGAGCTGTGGCCGGG + Intronic
1121164639 14:91780539-91780561 CAACACAAATAGCTGCAGCCTGG - Exonic
1121750297 14:96348588-96348610 CAAAAGAATCACTTGGACCCAGG + Intronic
1122411807 14:101529425-101529447 GGAAGTAATTAGCTGGAGCCTGG + Intergenic
1122656246 14:103261544-103261566 CAAAAGAATTACTTGAACCCGGG - Intergenic
1122700244 14:103583446-103583468 CAGGAGAATTTGCTGGAACCCGG + Intronic
1122911948 14:104834427-104834449 CAAAAGAATTAAATGGAGGCTGG - Intergenic
1123677872 15:22730001-22730023 CACAAGAATCACCTGAAGCCAGG - Intergenic
1124330072 15:28804268-28804290 CACAAGAATCACCTGAAGCCAGG - Intergenic
1124649878 15:31466614-31466636 CAAAAAAATTAGCCGGGGCCAGG - Intergenic
1124854350 15:33372658-33372680 ACAAAAAATTAGCTGGGGCCGGG - Intronic
1124892668 15:33747515-33747537 CAAAAGAATTGCTTGAAGCCAGG - Intronic
1124998036 15:34743216-34743238 CAAAGGAAATAGCTTGAGCATGG - Intergenic
1125112655 15:36051249-36051271 CAAATGAACAAGCTGGAGTCTGG - Intergenic
1125178143 15:36849467-36849489 CAAGAAAATTAGCTGATGCCAGG + Intergenic
1125435005 15:39635177-39635199 TACAAAAATTAGCTGGAGCATGG + Intronic
1127120969 15:55771745-55771767 CAAAAAAATTAGCCGGGGCATGG + Intergenic
1127455993 15:59156478-59156500 CTTAAAAATTAGCTGCAGCCAGG - Intronic
1128285884 15:66436735-66436757 CAGATGAATTAGCTGGAGAAAGG - Exonic
1130308707 15:82734155-82734177 CAAATAAATTAGCTGGGGCCAGG + Intergenic
1130354983 15:83120859-83120881 GATAAGAATGAGCTGGAGCCGGG - Intronic
1131964040 15:97819597-97819619 CAAAAGAAATACCTGGGGCAGGG + Intergenic
1133257849 16:4528894-4528916 CAAAAGAATTACTTGAACCCAGG + Intronic
1135558630 16:23457723-23457745 TAAAAGAATCAGCTGCAGGCCGG + Intergenic
1135566835 16:23517522-23517544 GAAAAAAATTAGCTGGGGCCGGG - Intronic
1136034286 16:27527112-27527134 CAAGAGGATTAGCTTGAGCCTGG + Intronic
1136471068 16:30480652-30480674 CAAAAGAATTATCTGAGGCAAGG + Intronic
1138486432 16:57347814-57347836 CAAAAAAATTAGCTGGGGCATGG + Intergenic
1138742445 16:59326528-59326550 CAAAAGAATTAGCCCGGGCGTGG - Intergenic
1139127420 16:64095947-64095969 CAAAAGCATTAGATGAAGCAGGG + Intergenic
1139394106 16:66626306-66626328 CTAAAAAATTAGCTGTGGCCAGG + Intronic
1139542315 16:67627501-67627523 AGAAAAAATTAGCTGGGGCCAGG + Intronic
1139550778 16:67671825-67671847 CAAAAAAATTAGCTGGGCACTGG + Intergenic
1139710113 16:68769771-68769793 TAAAAACATTAGCTGGGGCCTGG + Intronic
1140327426 16:74018339-74018361 CAAAAGAATAAGCTCGGGCCGGG - Intergenic
1140446012 16:75028588-75028610 TAAAAGAAGTAGCAGGGGCCGGG - Intronic
1141105142 16:81227261-81227283 AAAAAAAATTAGCTGGGGCCAGG - Intergenic
1141463642 16:84192997-84193019 CAAAAAAATTAGCTGGGCACGGG - Intronic
1141521568 16:84583610-84583632 AAAAAAAATTAGCTGGGGCATGG - Intronic
1142068296 16:88075048-88075070 TAAAAAAATTAGCTGGGGCCGGG + Intronic
1142790469 17:2260414-2260436 CAAAAAAACTAGCTGGAAGCAGG - Intronic
1143349705 17:6278260-6278282 CATAAAAATAAGCTGGAGGCCGG - Intergenic
1144146608 17:12405084-12405106 AAAAAAAATTAGCTGGGGCGTGG - Intergenic
1144219129 17:13084050-13084072 CATCAGAATTAGTTGGGGCCAGG - Intergenic
1144545611 17:16192358-16192380 ACAAAAAATTAGCTGGGGCCGGG + Intronic
1145300900 17:21635817-21635839 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1145349400 17:22067461-22067483 CAAAAAAATTAGCTGGGGCCGGG + Intergenic
1145790325 17:27622620-27622642 CAGAAAAATTGTCTGGAGCCAGG - Exonic
1146110717 17:30086595-30086617 AAAAAAAATTAGCCGGGGCCGGG + Intronic
1146311612 17:31773034-31773056 CAAAAAAATTAACAGCAGCCAGG - Intergenic
1146923337 17:36728101-36728123 TAAAAGAATTAGCAGCAGCCAGG - Intergenic
1147474659 17:40699171-40699193 TTAAAAAATTAGCTGGAGGCTGG - Intronic
1147563902 17:41525004-41525026 CAAAGGAAATAGTTGCAGCCAGG + Intronic
1147648265 17:42047325-42047347 CAAAAAAATTAGCCGGGGCCAGG - Intronic
1147799444 17:43072861-43072883 AAAAAAAACTAGCTGGGGCCAGG - Intronic
1148882080 17:50736363-50736385 CAAGAGAATTGCTTGGAGCCAGG + Intronic
1148939880 17:51199249-51199271 CAAAAAAATTAGCTGGGCCTGGG - Intronic
1148978707 17:51552071-51552093 AGACAGAATGAGCTGGAGCCTGG + Intergenic
1149482171 17:57012521-57012543 AAAAAGAATTAGCTGGTGGCCGG - Intergenic
1149590919 17:57829370-57829392 CAAATGGATGAGCTGGGGCCAGG + Intergenic
1149600697 17:57891301-57891323 CAAAGGTTTTGGCTGGAGCCAGG - Intronic
1150068554 17:62132557-62132579 CAAAAGAATCTGCTTGGGCCAGG + Intergenic
1150155424 17:62849165-62849187 CACAAAAATTAGCTGGGACCAGG - Intergenic
1150287283 17:63961484-63961506 CAAAAGCTCTAGCTGGAGCCGGG - Intronic
1150679962 17:67276764-67276786 ACAAAAAATTAGCTGGGGCCAGG - Intergenic
1151494885 17:74453430-74453452 CCACAGAGCTAGCTGGAGCCAGG - Intergenic
1151730089 17:75905843-75905865 CACAAGAATTAACTTGAACCCGG + Intronic
1152832787 17:82508972-82508994 CAAAAAAATGAGCTGGTGGCCGG + Intergenic
1156795971 18:41046444-41046466 CAAAAAAATTAGCATTAGCCGGG - Intergenic
1157685137 18:49637290-49637312 CAAAAAAATTAGCGGAGGCCAGG - Intergenic
1157869040 18:51212452-51212474 AAAAAAAATTAGCTGGGGCGTGG + Intronic
1159979403 18:74758743-74758765 CAAAACAATTAGCTGGACATGGG - Intronic
1160186902 18:76682833-76682855 CAAAAAAATGGGCTGGAGCTGGG - Intergenic
1160470657 18:79129834-79129856 CAAAAGAATCACTTGAAGCCGGG - Intronic
1161195787 19:2985778-2985800 CAAAAAGAGTAGCTGGGGCCAGG + Intronic
1161300739 19:3541900-3541922 CAGGAGAATTAGCTTGAACCCGG - Intronic
1161544773 19:4873734-4873756 CAGAAGAATTACTTGAAGCCAGG + Intergenic
1161673552 19:5628255-5628277 AAAAAGAATCAGCTGAAGCTGGG + Intronic
1161992984 19:7695619-7695641 TAAAAAAATTAGCTAGGGCCAGG + Intronic
1162050561 19:8029871-8029893 TAAAAAAATTAGCTGGGGCTGGG + Intronic
1162050603 19:8030177-8030199 AAAAAAAATTAGCTGGGGCCGGG + Intronic
1162055006 19:8057313-8057335 AATAATAATGAGCTGGAGCCAGG - Intronic
1162104063 19:8359424-8359446 AAAAAAAATTAGCTGGGGCCCGG - Intronic
1162104117 19:8359732-8359754 TTAAAAAATTAGCTGGGGCCAGG - Intronic
1162125110 19:8495393-8495415 TAAAAAAACTAGCTGGGGCCGGG - Intronic
1162126626 19:8502845-8502867 CAAAAGAATTGCCTGAACCCGGG - Exonic
1162309615 19:9898204-9898226 TAAAAAAATTAGCTGGGGCCAGG - Intronic
1162367044 19:10255990-10256012 ACAAAAAATTAGCTGGGGCCAGG + Intronic
1162530792 19:11235403-11235425 TACAAAAATTAGCTGGGGCCAGG - Intronic
1163504706 19:17698739-17698761 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1163715839 19:18871515-18871537 AAAAAAAGTTAGCTGGGGCCAGG - Intronic
1163718477 19:18886252-18886274 TATAAAAATTAGCTGGGGCCGGG + Intronic
1163733543 19:18964423-18964445 CAAAACAATGAGCTGGGGCCAGG + Intergenic
1164077431 19:21833420-21833442 CAAAAAAATTAGCTGGGTGCAGG - Intronic
1164649867 19:29884011-29884033 TATAAAAATTAGCTGGAGGCTGG - Intergenic
1165097977 19:33420405-33420427 AAAAATAATTAGCTGTGGCCGGG + Intronic
1165163976 19:33837854-33837876 CAAGAGAATTGCCTGGACCCAGG + Intergenic
1165449814 19:35875614-35875636 TACAAAAATTAGCTGGGGCCGGG - Intronic
1165715343 19:38041570-38041592 TACAAAAATTAGCTGGGGCCTGG - Intronic
1166337865 19:42119578-42119600 CAAGAGAATCACCTGAAGCCGGG + Intronic
1166757805 19:45204343-45204365 CAAAAAAATTAGCTGGGGCATGG - Intronic
1166774021 19:45301702-45301724 TACAAAAATTAGCTGGGGCCAGG + Intronic
1166780135 19:45337830-45337852 AGAAAGAAATAGCTGGAGCTTGG + Intronic
1166849512 19:45752500-45752522 CAAAAATATTAGCCAGAGCCAGG - Intronic
1167518118 19:49935164-49935186 AAAAAAAATTAGGTGGGGCCGGG + Intronic
1167558332 19:50209800-50209822 GAAAATAATTAGCCGGGGCCGGG + Intronic
926079519 2:9973089-9973111 AAAAAGAATTGGCAGGAGGCGGG - Intronic
926327854 2:11800498-11800520 CAAAAGAATCACTTGGACCCGGG - Intronic
926902307 2:17766258-17766280 CACAAGAATTACTTGAAGCCAGG - Intronic
927552882 2:24014306-24014328 CACAAAAATTAGCTGTAGACTGG - Intronic
927984804 2:27401731-27401753 CAAGAGAATTCGCTTGAACCTGG + Intronic
928501648 2:31902597-31902619 CTAAAGAATTAGCAAGAACCTGG - Intronic
928917523 2:36489001-36489023 GAAAAGAATAAGCTGCAGTCAGG - Intronic
929194742 2:39173512-39173534 ACAAAAAATTAGCTGGAGCCGGG + Intergenic
930509245 2:52324278-52324300 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
930628079 2:53720962-53720984 CAAAAAAATTAGCTGGCCACAGG + Intronic
931409122 2:62012094-62012116 CAAAAAAATTAGCTGGGGCTGGG + Intronic
931452906 2:62383553-62383575 AAAAAGAATGGGCTGTAGCCTGG - Intergenic
931711488 2:64991894-64991916 TAAAACAGTTAGCTGGGGCCAGG - Intronic
932606282 2:73167846-73167868 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
933539840 2:83625642-83625664 GAAAAGAGATAGCTGGAGTCTGG + Intergenic
933693887 2:85201107-85201129 CACAAGAATTCGCTTGAACCTGG + Intronic
933926147 2:87092596-87092618 TTAAAAAATTAGCTGGGGCCAGG + Intergenic
937909425 2:127068395-127068417 CGAGAGAATTAGGGGGAGCCCGG + Intronic
938615303 2:132991578-132991600 CAAAGCAATTAGCAGGGGCCTGG + Intronic
939539419 2:143475197-143475219 ACAAAGATCTAGCTGGAGCCCGG - Intronic
941280231 2:163540726-163540748 CAAAACAATTAGCTGGAGTGTGG + Intergenic
941727030 2:168872065-168872087 CAAAAGAATTGCTTGAAGCCAGG - Intronic
942026400 2:171914820-171914842 TAAAAAAATTAGCTGGGGCCAGG + Intronic
942355996 2:175110696-175110718 CACAAGAATTTGCTTGAACCCGG - Intronic
942468856 2:176238789-176238811 CAAAAGAATTGCCTGAAACCAGG - Intergenic
943662000 2:190569019-190569041 CAAAAGAAACAGCTGAGGCCAGG + Intergenic
944108622 2:196107131-196107153 CAAAAGAATTGCCTGAACCCGGG - Intergenic
944744432 2:202640905-202640927 CAAAAGAATTCCCTTTAGCCGGG - Intronic
946040293 2:216777100-216777122 CAAAAGAACTGGATGGAGTCTGG + Intergenic
946218750 2:218207901-218207923 CAAAAAAATTAGCTGGGGTGTGG + Intergenic
946258090 2:218461858-218461880 ATAAAAAATTAGCTGGAACCTGG + Intronic
946718482 2:222578682-222578704 CAAAAAAATTAGCTGGGGCCGGG + Intronic
946794614 2:223336665-223336687 CAAAAAAATTAGCAGGGGCATGG + Intergenic
947609042 2:231511012-231511034 CAAAAGAATTACCTGAACTCAGG + Intergenic
948249835 2:236518002-236518024 AAAAGGAACTAGCTGGAGGCAGG + Intergenic
948502903 2:238408041-238408063 CACAAGAAAAAGCTGGAGCAGGG + Intergenic
1168812243 20:711658-711680 CAACAGAACTGGCTGGAGGCTGG - Intergenic
1169121272 20:3097434-3097456 AAAAAAAATTAGCTGGTGGCCGG - Intergenic
1169548900 20:6681008-6681030 CAAAAGCCTCAGCTGCAGCCTGG - Intergenic
1169666618 20:8044251-8044273 TTTAAAAATTAGCTGGAGCCTGG + Intergenic
1170781286 20:19427736-19427758 AAAAAGTATTTGCTGGAGGCTGG + Intronic
1171453942 20:25256026-25256048 CAAAAGAAAGAGCTGGAGCCAGG - Intronic
1171559306 20:26108467-26108489 CCAAAAAATTAGCTGGGGCCGGG + Intergenic
1172069430 20:32245676-32245698 TTAAACAATTAGCTGGGGCCCGG + Intergenic
1172312428 20:33929018-33929040 TAAAAAAATTAGCTGGCGCTGGG - Intergenic
1172576371 20:36012001-36012023 TACAAAAATTAGCTGGGGCCAGG + Intronic
1173088860 20:39951262-39951284 CAAAATACTTAGTTGAAGCCAGG - Intergenic
1173096680 20:40038123-40038145 CAAAGTACTTAGCTGGGGCCTGG + Intergenic
1173521244 20:43701868-43701890 TTAAAAAATTAGCTGAAGCCGGG + Intronic
1174608109 20:51776046-51776068 TAAAAGAATTAGCTGGGTCACGG + Intergenic
1175547603 20:59788647-59788669 CATCAGAAAGAGCTGGAGCCAGG - Intronic
1176651646 21:9553616-9553638 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1178565425 21:33679850-33679872 CAAAAAAATTAGCTGGATGTGGG - Intronic
1179483390 21:41692898-41692920 CAAAAGAAGTAGCCGGGGCCGGG + Intergenic
1179578997 21:42326885-42326907 CAAAAAAATTAGCTGGACATTGG + Intergenic
1180925397 22:19550272-19550294 TATAAAAATTAGCTGGGGCCAGG - Intergenic
1180974425 22:19839581-19839603 AAAAATAATTAGCTGGGGCAGGG + Intronic
1181152071 22:20891666-20891688 CAAAATGATGAGCTAGAGCCAGG + Intergenic
1181295661 22:21836547-21836569 CAAAAAAATTATCTGTAGCCGGG + Intronic
1181371668 22:22423947-22423969 CAAAAGAATTACTTGAGGCCAGG + Intergenic
1181833982 22:25587043-25587065 CACAAAAATTAGCTGTAGCTGGG - Intronic
1182454591 22:30441902-30441924 CAAAAGAATCAGTTGAACCCAGG + Intergenic
1182631693 22:31690934-31690956 AAAAAAAATTAGCTGGAGGCCGG - Intronic
1183151521 22:36041544-36041566 CCAAAAAATTAGCTGAGGCCGGG + Intergenic
1183459076 22:37938906-37938928 CAAAAAAATTAGCCAGGGCCGGG - Intronic
1183573808 22:38674201-38674223 AAAAAGAATTAAATGGAGCCTGG + Intergenic
1183573853 22:38674518-38674540 AAAAAAAAGTAACTGGAGCCTGG + Intergenic
1183835330 22:40448014-40448036 CAAAAAAATTAGCTGGGGCTGGG + Intronic
1184032578 22:41903643-41903665 AAAAGGAAATAGCTGGAGCCTGG - Intronic
1184081040 22:42220483-42220505 TGAAAAAATTAGCTGGGGCCAGG - Intronic
1184207636 22:43015080-43015102 CAAAAGCGGTAGCGGGAGCCCGG - Exonic
1184304852 22:43590835-43590857 CAAAAGAGTCAGCTGGGGACTGG + Intronic
1185381767 22:50511940-50511962 TACAAAAATTAGCTGGGGCCAGG - Intronic
949153068 3:793815-793837 CAAAAAAATTAGCTGGGTTCGGG + Intergenic
949525654 3:4900728-4900750 CCAAAAAATCAGCTGGGGCCTGG + Intergenic
949542456 3:5044225-5044247 CCAAAGAGTTAACTGGGGCCTGG - Intergenic
952006522 3:28847811-28847833 CAAAAGAATAAGCTGCATACAGG + Intergenic
952270586 3:31827206-31827228 AAAAATAATTAGGTGAAGCCAGG - Intronic
952488474 3:33841118-33841140 CACAAGAATCACCTGAAGCCGGG - Intronic
952920962 3:38283532-38283554 CATCAGAAGTAGCAGGAGCCGGG + Intronic
953976990 3:47389457-47389479 AATAAAAATTAGCTGGGGCCAGG + Intronic
954062427 3:48079497-48079519 TACAAAAATTAGCTGGGGCCTGG + Intronic
954217897 3:49134481-49134503 CAAAATAAATAGATGGGGCCTGG - Intergenic
954823682 3:53352760-53352782 CAAAAGAATTGCCTGAACCCGGG - Intergenic
954893526 3:53955153-53955175 CAAAAGAATAAGGTAGGGCCAGG + Intergenic
955906541 3:63813780-63813802 CAAGAGGATTTGCTTGAGCCAGG + Intergenic
956464618 3:69506692-69506714 CAAAAAAATTAGCTGTAGCTGGG - Intronic
956586099 3:70866604-70866626 TCAAAGAATAAGATGGAGCCTGG + Intergenic
956774207 3:72551443-72551465 TTAAAAAATTAGCTGGAGGCTGG + Intergenic
956897451 3:73677957-73677979 CAGGAGAATTAGCTTGAACCTGG - Intergenic
960046951 3:113208391-113208413 CAAAACAGTTAGGTGGAGTCTGG - Intergenic
960911618 3:122654854-122654876 CAAAAAAATTAGCTGGGGCATGG + Intergenic
962149841 3:132881215-132881237 CAAAGGGAGTGGCTGGAGCCTGG + Intergenic
962201662 3:133405148-133405170 CAAAAGGAACAGCTGAAGCCAGG + Intronic
962602043 3:136999389-136999411 TAAAATAATTAGCTGTGGCCAGG - Intronic
964092747 3:152895378-152895400 CAAAAGAATCACCTGAAACCGGG + Intergenic
964795512 3:160492708-160492730 CAGAAGAATTGGCTTGAACCTGG - Intergenic
966818697 3:183908755-183908777 CACAAGAATTGCCTGAAGCCAGG + Intergenic
968329436 3:197853280-197853302 CAGAAGAATCAGTTGGACCCGGG - Intronic
969043377 4:4318512-4318534 CACAAGAATTAACTTGAACCCGG + Intronic
972223893 4:36989512-36989534 TAAAATAATTAGGTGGAGCCAGG + Intergenic
972476532 4:39455533-39455555 CTTAAAAATTAGCTGGGGCCAGG + Intronic
972698443 4:41470495-41470517 GAAAAGAAGTAGCTGGAGATGGG - Intronic
972752677 4:42007594-42007616 ACAAAAAATTAGCCGGAGCCGGG + Intronic
973267436 4:48225265-48225287 CAAGAGAATTGCTTGGAGCCAGG - Intronic
973629906 4:52810741-52810763 AAAAAAAATTAGGTGGGGCCGGG + Intergenic
973905919 4:55530680-55530702 CAGAAGAATCAGCTGAACCCAGG + Intronic
973965977 4:56162348-56162370 CACAAGAATTAGCAGGGGCATGG - Intergenic
974195676 4:58571432-58571454 TCAAGGAATCAGCTGGAGCCAGG + Intergenic
975156116 4:71074972-71074994 TAAAAGGATTAGCTTGAACCTGG + Intergenic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
977575730 4:98672366-98672388 CCAAAGAATGAGATGCAGCCAGG + Intergenic
979438911 4:120727781-120727803 CAAAAAAATTAGCTGGACAGTGG + Intronic
979660834 4:123253185-123253207 CAAAAGAAATAGCTGGGGCTGGG + Intronic
979836762 4:125379550-125379572 CAAAAGAATTGCTTGAAGCCAGG - Intronic
980123938 4:128755402-128755424 CAGGAGAATTAGCTTGAACCTGG - Intergenic
981470480 4:145128641-145128663 GAACAGGATTACCTGGAGCCTGG + Exonic
981977478 4:150748371-150748393 CAAAAGAATGAAATTGAGCCAGG + Intronic
982599693 4:157431545-157431567 CAAAGGAATAAGCGGGAACCAGG - Intergenic
983556970 4:169067834-169067856 CAAAAAAATTAGCCGGGGCCGGG + Intergenic
983778361 4:171637519-171637541 CACAAAAATTAGCTGGAGAGTGG - Intergenic
983987594 4:174078997-174079019 CAAAAGAAACAGCTAGAGCGAGG - Intergenic
986036248 5:3943085-3943107 TAAAAGAAGTAAATGGAGCCAGG + Intergenic
986286001 5:6359720-6359742 CAAAAGCAGCAGCTGGGGCCCGG - Intergenic
987218984 5:15770159-15770181 TAACAGAGTTAGCTGCAGCCTGG - Intronic
988395593 5:30694004-30694026 CAAAAAAATTAGCCGGGGCGAGG + Intergenic
988414210 5:30925536-30925558 CAAAATAGTGAGGTGGAGCCAGG + Intergenic
988932315 5:36048370-36048392 CAGAAGATCTAGGTGGAGCCAGG + Intronic
989046850 5:37282224-37282246 CATAAGATTTAGGAGGAGCCAGG - Intergenic
990832846 5:59979712-59979734 GAAAGGAAGTAGATGGAGCCGGG - Intronic
990898381 5:60724278-60724300 AAAAAAGATTAGCTGGAGCAAGG + Intergenic
992208591 5:74455098-74455120 CACAAGAATTAGCTGGTGCGTGG + Intergenic
992799685 5:80284665-80284687 CAAAAAAATTAGCTTGAACCCGG + Intergenic
992983141 5:82198345-82198367 CACAAGAATTAGTTGAACCCAGG - Intronic
995252978 5:110015611-110015633 CAAAAGAATTGCTTGAAGCCAGG + Intergenic
996102720 5:119460905-119460927 CAGAAGAAGCAGCTGAAGCCAGG + Intronic
996142743 5:119932715-119932737 CAGCAGCCTTAGCTGGAGCCAGG - Intergenic
996240666 5:121197189-121197211 CAAAGGAAGTACCTAGAGCCTGG + Intergenic
997206929 5:132055683-132055705 CTAAAGGATGATCTGGAGCCAGG - Intergenic
998020424 5:138765334-138765356 TAAGAAAATTAGCTGGGGCCGGG - Intronic
998150506 5:139754539-139754561 CAAAAAAAATAGCTGGGGCGTGG + Intergenic
1001440897 5:171742009-171742031 CAAAAGAATGAGGAGGGGCCAGG + Intergenic
1001599641 5:172920500-172920522 AAAAACATATAGCTGGAGCCAGG - Intronic
1001759894 5:174198718-174198740 CAAAAGGATGTGCTCGAGCCTGG - Intronic
1002863712 6:1102607-1102629 CAACAGAATCACCTGGACCCTGG + Intergenic
1003025424 6:2550913-2550935 CAAAAGAATTAGGAGGGGGCAGG + Intergenic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1005720572 6:28597723-28597745 CAGAGGAGCTAGCTGGAGCCAGG - Intronic
1007003308 6:38335547-38335569 AAAAAGAACTACCTGGAGGCTGG - Intronic
1007211922 6:40199515-40199537 CAAAAAAATTAGCTGGGGCGTGG - Intergenic
1007620415 6:43210069-43210091 CAGGAGAATTGGCTTGAGCCTGG - Intronic
1008174914 6:48255879-48255901 AAAAAAAATTATCTGAAGCCAGG + Intergenic
1008389571 6:50934114-50934136 CAAAAGAATTACTTGAACCCAGG + Intergenic
1010704702 6:79093856-79093878 CAAGAGAATTACTTGAAGCCCGG + Intergenic
1011485853 6:87840799-87840821 AAAAAAAATTAGCTGGGGCATGG - Intergenic
1012258850 6:97064622-97064644 AAACAGATTTTGCTGGAGCCAGG + Exonic
1012430193 6:99155851-99155873 CAAAAAAATTAGCTGGGCCTGGG + Intergenic
1013107412 6:107037363-107037385 TACGAAAATTAGCTGGAGCCAGG - Intronic
1013393159 6:109706952-109706974 GACAGGAATTAGCTGAAGCCTGG + Intronic
1015748719 6:136538628-136538650 AAAAAAAATTAGCTGGTGCTAGG + Intronic
1015772814 6:136786221-136786243 CAAAAAAATTAGCTGGAATGTGG + Intronic
1016771078 6:147851624-147851646 GGAAATAATTACCTGGAGCCTGG - Intergenic
1017275921 6:152568393-152568415 CACAAGAATTACTTGGACCCAGG - Intronic
1017289654 6:152721072-152721094 CAGAAGCATGAGCTGGAACCTGG + Intronic
1017969049 6:159294705-159294727 CAGAAGAAATAGCTGGAGAAGGG + Intergenic
1018308130 6:162479770-162479792 AAAAATAATTAGTAGGAGCCAGG + Intronic
1018681290 6:166268103-166268125 CAAAAGCATTAGTTGGACACTGG + Intergenic
1019511638 7:1420529-1420551 CAAGAGAAATAGATGGGGCCGGG - Intergenic
1019939156 7:4275634-4275656 TAAAAGAATGAGATGGGGCCGGG + Intergenic
1020070052 7:5221259-5221281 CAAAAGAATTAGCTGGGTGTGGG - Intronic
1021649507 7:22820038-22820060 TAAAAGAACAACCTGGAGCCAGG + Intronic
1022058106 7:26761805-26761827 CACAAGAATTGGTTGAAGCCAGG + Intronic
1022583360 7:31579650-31579672 CAAAAGAATAGGATTGAGCCAGG + Intronic
1022682755 7:32565710-32565732 TCAAAAAATTAGCTGGAGCCAGG + Intronic
1024008857 7:45251070-45251092 TAAAATAATTAGCTGAGGCCAGG + Intergenic
1024600678 7:50977951-50977973 TAAAAAAATTAGCTGGACTCAGG + Intergenic
1025030457 7:55552598-55552620 CAAAAGAAAGTGCTGGAACCAGG + Intronic
1026112785 7:67471491-67471513 TAAAAGACTTAGCTGAAGCCGGG - Intergenic
1026522198 7:71127247-71127269 CAAAAGAATTACTTGAACCCAGG - Intergenic
1026995542 7:74613656-74613678 AAAAAAAATTAGCTGTGGCCAGG - Intergenic
1027148786 7:75717534-75717556 TAAAAGAATTAGCCGGGGCCCGG + Intronic
1027397808 7:77774431-77774453 TACAAAAATTAGCTGGGGCCAGG + Intronic
1028131507 7:87181002-87181024 CAGAAAAATTAGCTGGTGGCAGG - Intronic
1029533697 7:101142828-101142850 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
1029533716 7:101142956-101142978 TTAAAAAATTAGCTGGGGCCGGG - Intergenic
1029555718 7:101267691-101267713 CAAAAATATTAGCAGGGGCCGGG - Intergenic
1029829696 7:103243952-103243974 CAGAAGAATCAGCTTGAACCAGG - Intergenic
1029925891 7:104316572-104316594 CATAAGAATTACTTGGACCCGGG + Intergenic
1032398525 7:131607890-131607912 CCAAAGACCTCGCTGGAGCCGGG + Intergenic
1032681520 7:134189284-134189306 CAAAGAAATTTGCTCGAGCCAGG - Intronic
1033067017 7:138165934-138165956 ATAAAGAAGTAGCTGCAGCCAGG + Intergenic
1033324358 7:140365100-140365122 GACAATAATTAGCTGGAGACAGG + Intronic
1033958884 7:146887691-146887713 CAAAAGAATTAAGTTGAGTCTGG + Intronic
1033972586 7:147060566-147060588 CAAAAAAAATATCTGGGGCCGGG + Intronic
1034636594 7:152572085-152572107 TAAAAGAATCAACTGGGGCCGGG - Intergenic
1034702994 7:153113089-153113111 CAAGAGAATCGGCTTGAGCCAGG - Intergenic
1034761132 7:153672935-153672957 CAAAAAAATTAGCTGGGGCATGG - Intergenic
1035038413 7:155910241-155910263 CTAAATAATCAGCTGGACCCAGG - Intergenic
1035604118 8:917873-917895 CAAAAGAATACTCTGGAGGCCGG - Intergenic
1036403079 8:8427757-8427779 CTAGAGAATTAGTTGGAGCTAGG - Intergenic
1036526494 8:9539688-9539710 TAGAAAAATTAGCTGGGGCCTGG - Intergenic
1036595746 8:10210421-10210443 CAAAAGTATGATCTGCAGCCAGG + Intronic
1036812335 8:11875985-11876007 CAAAAGAATTGCTTGAAGCCAGG - Intergenic
1038321305 8:26529813-26529835 GAAAAGAATTAACTGGGGCCGGG + Intronic
1039491461 8:37950757-37950779 CAAGAGAATTACCTGAATCCGGG + Intergenic
1039514433 8:38119968-38119990 CAAAAAAATTAGCTGGGCCTGGG + Intronic
1039535568 8:38309169-38309191 CCAAAAAACTAGCTGGAGGCTGG + Intronic
1039551125 8:38443756-38443778 CAAAAGAATTAGATGGCGCTGGG + Intronic
1042549787 8:69984089-69984111 CAAGAGAATTACTTGAAGCCAGG + Intergenic
1043085955 8:75833393-75833415 CAAAAGTATTAGCAGCAACCTGG + Intergenic
1043827367 8:84945785-84945807 AAAAAAAAGTAGTTGGAGCCTGG - Intergenic
1044297991 8:90550531-90550553 CAAGTGAATTAGCTGGTGTCAGG + Intergenic
1047517921 8:125571012-125571034 CACAAAAATTAGCTGGGGGCGGG - Intergenic
1047591837 8:126335387-126335409 ACAAAAAATTAGCTGGGGCCTGG + Intergenic
1048319778 8:133389344-133389366 CAGAAGAATTGGCTAGAGACTGG - Intergenic
1049439259 8:142601770-142601792 CAGACGAACTAGCAGGAGCCCGG + Intergenic
1049722076 8:144122366-144122388 AACAAAAATTAGCTTGAGCCTGG + Intergenic
1050262163 9:3851988-3852010 CAAAAAAATTAGCTGGATGTGGG + Intronic
1051163325 9:14233519-14233541 CAAGAGAATTTGCTTGAACCTGG - Intronic
1051275651 9:15395444-15395466 TAAAAAAATTAGCTGGGGCCAGG + Intergenic
1051892380 9:21956388-21956410 TAAATGAATTAGATGCAGCCTGG + Intronic
1052353428 9:27480593-27480615 TACAAAAATTAGCTGGGGCCAGG - Intronic
1052828372 9:33194378-33194400 ACAAAAAATTAGCTGGGGCCGGG + Intergenic
1052868705 9:33482600-33482622 AAAAAAAATTAGCTGGGGCTGGG + Intergenic
1053337199 9:37286553-37286575 CACAAGAATTTGCTTGAGTCCGG + Intronic
1053402197 9:37835281-37835303 AAAAAAAATTAGCTGGGGCCGGG + Intronic
1054549592 9:66386587-66386609 CAGAAGAATCCGCTGGACCCAGG - Intergenic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1055060614 9:72064781-72064803 AGAAAGAATTAGCTGGTGTCTGG + Intronic
1055173172 9:73285742-73285764 CAAAAAAATTAGCTGGGCCTGGG + Intergenic
1055578470 9:77683258-77683280 CAAAAAAATTAGCTGGATGTGGG + Intergenic
1056365645 9:85901879-85901901 GAAAAGAATTACCTGAAGCCAGG - Intergenic
1056671092 9:88627448-88627470 GAAATGCATCAGCTGGAGCCCGG + Intergenic
1057551111 9:96051362-96051384 CCAAAGAATGAGCTGTAGCAAGG + Intergenic
1058454120 9:105123451-105123473 ACAAAAAATTAGCTGGAGGCTGG - Intergenic
1058697729 9:107573987-107574009 AAAAATAATTAGCTGGGGCCAGG - Intergenic
1059369077 9:113810720-113810742 CAAAGCAATTAACTGGAGTCAGG + Intergenic
1059937831 9:119329337-119329359 CAGAAGAATTAGCTGAACCATGG - Intronic
1060430917 9:123551009-123551031 TAAATAAATGAGCTGGAGCCTGG + Intronic
1061097636 9:128468815-128468837 TAAAAGAATTAGCTAGCGCTGGG - Intronic
1061145511 9:128795753-128795775 AAAAAAAATTAGTTGGGGCCAGG - Intronic
1061147994 9:128811387-128811409 CAAAAAAATTATTTAGAGCCGGG + Intergenic
1061314836 9:129788441-129788463 AAAAAGAAAGTGCTGGAGCCAGG - Intergenic
1062179068 9:135180989-135181011 CAAGAAAATTAGCAGGTGCCTGG + Intergenic
1203629377 Un_KI270750v1:57171-57193 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1185454639 X:302664-302686 CAGGAGAATTTGCTGGAACCCGG - Exonic
1185888413 X:3802738-3802760 TAAAAAAATTAGCTGGGGCTGGG + Intergenic
1187454191 X:19426722-19426744 CAGGAGAATTAGCTTGAACCCGG + Intronic
1188132511 X:26454639-26454661 CAGAAGAATTTGCTTGAACCTGG - Intergenic
1189249122 X:39586321-39586343 CAATAGAATTATCTGGTTCCTGG - Intergenic
1189433563 X:40970935-40970957 AAAAAAAATTAGCTGGGGCCGGG - Intergenic
1189514909 X:41703645-41703667 CAAAAGAATTCACTTGAGCATGG - Intronic
1193342911 X:80372589-80372611 AAAAAGTATTAGGTTGAGCCAGG + Intronic
1194461422 X:94174410-94174432 CAAAAGAAGTAGATAGATCCAGG + Intergenic
1196243798 X:113374433-113374455 CAAAAAAATTAGCCGGTGGCGGG - Intergenic
1197788875 X:130230309-130230331 CAAAACAACTAGGTGGATCCTGG + Intronic
1198198733 X:134392950-134392972 CAAAAAAATTAGCTGGGGTGTGG - Intronic
1200333115 X:155319243-155319265 CAAAAGAAATAACTGGGGGCTGG + Intronic
1200821436 Y:7587675-7587697 CATAAGAATTAGCTGGGGTTGGG - Intergenic
1202238868 Y:22745077-22745099 CATAAGAATTAGCTGGGGTTGGG + Intergenic