ID: 907043080

View in Genome Browser
Species Human (GRCh38)
Location 1:51280942-51280964
Sequence CTTACCCCATTCCCAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907043080_907043083 24 Left 907043080 1:51280942-51280964 CCTGTTCTTGGGAATGGGGTAAG No data
Right 907043083 1:51280989-51281011 TGAAAGAAAGGACATAATAGTGG No data
907043080_907043082 12 Left 907043080 1:51280942-51280964 CCTGTTCTTGGGAATGGGGTAAG No data
Right 907043082 1:51280977-51280999 TATATCAACTTTTGAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907043080 Original CRISPR CTTACCCCATTCCCAAGAAC AGG (reversed) Intergenic
No off target data available for this crispr