ID: 907043082

View in Genome Browser
Species Human (GRCh38)
Location 1:51280977-51280999
Sequence TATATCAACTTTTGAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907043080_907043082 12 Left 907043080 1:51280942-51280964 CCTGTTCTTGGGAATGGGGTAAG No data
Right 907043082 1:51280977-51280999 TATATCAACTTTTGAAAGAAAGG No data
907043071_907043082 30 Left 907043071 1:51280924-51280946 CCACTGTTCTCATCCTCCCCTGT No data
Right 907043082 1:51280977-51280999 TATATCAACTTTTGAAAGAAAGG No data
907043075_907043082 17 Left 907043075 1:51280937-51280959 CCTCCCCTGTTCTTGGGAATGGG No data
Right 907043082 1:51280977-51280999 TATATCAACTTTTGAAAGAAAGG No data
907043079_907043082 13 Left 907043079 1:51280941-51280963 CCCTGTTCTTGGGAATGGGGTAA No data
Right 907043082 1:51280977-51280999 TATATCAACTTTTGAAAGAAAGG No data
907043078_907043082 14 Left 907043078 1:51280940-51280962 CCCCTGTTCTTGGGAATGGGGTA No data
Right 907043082 1:51280977-51280999 TATATCAACTTTTGAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907043082 Original CRISPR TATATCAACTTTTGAAAGAA AGG Intergenic
No off target data available for this crispr