ID: 907043083

View in Genome Browser
Species Human (GRCh38)
Location 1:51280989-51281011
Sequence TGAAAGAAAGGACATAATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907043079_907043083 25 Left 907043079 1:51280941-51280963 CCCTGTTCTTGGGAATGGGGTAA No data
Right 907043083 1:51280989-51281011 TGAAAGAAAGGACATAATAGTGG No data
907043078_907043083 26 Left 907043078 1:51280940-51280962 CCCCTGTTCTTGGGAATGGGGTA No data
Right 907043083 1:51280989-51281011 TGAAAGAAAGGACATAATAGTGG No data
907043080_907043083 24 Left 907043080 1:51280942-51280964 CCTGTTCTTGGGAATGGGGTAAG No data
Right 907043083 1:51280989-51281011 TGAAAGAAAGGACATAATAGTGG No data
907043081_907043083 -7 Left 907043081 1:51280973-51280995 CCTGTATATCAACTTTTGAAAGA No data
Right 907043083 1:51280989-51281011 TGAAAGAAAGGACATAATAGTGG No data
907043075_907043083 29 Left 907043075 1:51280937-51280959 CCTCCCCTGTTCTTGGGAATGGG No data
Right 907043083 1:51280989-51281011 TGAAAGAAAGGACATAATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907043083 Original CRISPR TGAAAGAAAGGACATAATAG TGG Intergenic
No off target data available for this crispr