ID: 907043474

View in Genome Browser
Species Human (GRCh38)
Location 1:51284238-51284260
Sequence ACCTTGGAAGGCTGCATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907043470_907043474 -2 Left 907043470 1:51284217-51284239 CCGAGCAGAAGGCACTTTCCGAC No data
Right 907043474 1:51284238-51284260 ACCTTGGAAGGCTGCATCTGAGG No data
907043468_907043474 8 Left 907043468 1:51284207-51284229 CCGTGCTAACCCGAGCAGAAGGC No data
Right 907043474 1:51284238-51284260 ACCTTGGAAGGCTGCATCTGAGG No data
907043469_907043474 -1 Left 907043469 1:51284216-51284238 CCCGAGCAGAAGGCACTTTCCGA No data
Right 907043474 1:51284238-51284260 ACCTTGGAAGGCTGCATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907043474 Original CRISPR ACCTTGGAAGGCTGCATCTG AGG Intergenic
No off target data available for this crispr