ID: 907043779

View in Genome Browser
Species Human (GRCh38)
Location 1:51286752-51286774
Sequence TTCCCTACGGGGAAATGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907043779 Original CRISPR TTCCCTACGGGGAAATGGTT AGG Intergenic
907043779 1:51286752-51286774 TTCCCTACGGGGAAATGGTTAGG + Intergenic
907293538 1:53434031-53434053 TTCTCTAAGAGGAAATTGTTGGG - Intergenic
911746154 1:101443931-101443953 TTCCCAAAGGTGAAAAGGTTTGG - Intergenic
913387533 1:118275988-118276010 TCCCCTACGGGGAAAAGACTGGG + Intergenic
916098914 1:161376702-161376724 TTCCCTTTGGGGAAATGTATGGG - Intergenic
918951774 1:191149856-191149878 TTCCTTGCGGGGAAATTGTGAGG - Intergenic
1063336397 10:5219299-5219321 ATCCCTGTGGGGTAATGGTTAGG + Intergenic
1065864278 10:29900268-29900290 TTCCCTTGGTGGAAATGGTGGGG - Intergenic
1066550890 10:36555514-36555536 ATCCCTAAGGAGAAATGGATTGG - Intergenic
1074122533 10:110503637-110503659 TTCCCTTCCGTAAAATGGTTAGG - Intronic
1077679178 11:4223516-4223538 TTCTCTAAGAGGAAATTGTTGGG + Intergenic
1077688614 11:4320158-4320180 TTCTCTAAGAGGAAATTGTTGGG + Intergenic
1082735319 11:56848601-56848623 ATACTTACGGGCAAATGGTTAGG - Intergenic
1085970953 11:81590113-81590135 TTCCCTAAGGGGAAATGAAAGGG + Intergenic
1088937555 11:114418857-114418879 TTCCTTACTGGGAACTGGTAGGG - Intronic
1092773036 12:11915806-11915828 TTCCCTCTGGGGAAAGGCTTTGG + Intergenic
1098366768 12:69711855-69711877 ATCCCAACAGGGAAATGGTGGGG + Intergenic
1099074982 12:78095623-78095645 TACTCTACTGGGAAATGGTGAGG + Intronic
1102097057 12:110249316-110249338 TGCACTGAGGGGAAATGGTTGGG - Intergenic
1105287414 13:19016691-19016713 TTCCCTAAGGGCAAATGGTGAGG - Intergenic
1106860631 13:33903750-33903772 TTCTCTTATGGGAAATGGTTTGG + Intronic
1107200043 13:37704194-37704216 TTGCCTACGGGGGAATGGGGAGG + Intronic
1109645243 13:65245600-65245622 TTCCCTCCTGGGAAAAGTTTAGG + Intergenic
1111630056 13:90839162-90839184 TTCCCTCCAGGGAAAGGGCTGGG + Intergenic
1112608914 13:100936541-100936563 TTCCATTTGGGGAAATGGTTAGG - Intergenic
1113235292 13:108266500-108266522 TTCCGGAAGAGGAAATGGTTTGG - Intronic
1113382123 13:109813681-109813703 TTCCTCAGGGGGAACTGGTTGGG + Intergenic
1119637955 14:76292103-76292125 TTCTCTACGAGGACATAGTTTGG - Intergenic
1120128767 14:80780395-80780417 TTCCTTAAGGGTAAATTGTTTGG + Intronic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1127192301 15:56543389-56543411 TTCCCTCTTGGGAAATGGTGAGG - Intergenic
1127555415 15:60082758-60082780 TTTCCTTTGGGGGAATGGTTAGG - Intergenic
1129925323 15:79358781-79358803 TTCCCTGGGGTGAAATGGCTGGG + Intronic
1130726597 15:86445458-86445480 TTCCCTATGGGGACATAGTGGGG + Intronic
1131496490 15:92915864-92915886 TTCCCTGTGGGCAAATTGTTAGG - Intronic
1131841195 15:96439739-96439761 TTCCCTATTTGTAAATGGTTTGG - Intergenic
1132407189 15:101550791-101550813 TTCCTTGCGGGCAAATGGTGAGG - Intergenic
1141575815 16:84962973-84962995 GTCTCTACGAGGAAATTGTTAGG - Intergenic
1155664165 18:28286992-28287014 TTTCATACTGAGAAATGGTTAGG - Intergenic
1157351796 18:46894546-46894568 TTCCCTACAGAGAAATGTGTTGG + Intronic
1159236555 18:65681550-65681572 TTCCCTACAGAGAATTGGTTTGG + Intergenic
926355531 2:12037644-12037666 CTCCCTACGTGGAGAGGGTTTGG - Intergenic
927681895 2:25145217-25145239 TTCCCTTCGGAAAAATTGTTAGG + Intronic
933236715 2:79872489-79872511 TTCTCTACTGGGCAATGATTTGG - Intronic
936375620 2:111938795-111938817 TTCCCTACAGGGAGAGGGCTGGG - Intronic
942521261 2:176806620-176806642 TGCCCCTCGGGGAAATAGTTTGG + Intergenic
948508395 2:238446812-238446834 TTCCCTACAGGGAAATTAGTAGG - Exonic
1176255136 20:64147794-64147816 TTCCCTACGCGGTTAGGGTTAGG - Intergenic
1178109904 21:29359737-29359759 TTCCTTACGGGCAAATTGTGAGG - Intronic
1180560847 22:16613078-16613100 TTCTCTAAGAGGAAATTGTTGGG - Intergenic
1183971293 22:41479518-41479540 CTCCCTCTGGGGAAACGGTTTGG - Intronic
952211175 3:31230989-31231011 TTCCCTACTGGGCTGTGGTTTGG - Intergenic
952215803 3:31277298-31277320 TTGCCTACGTTGAAATGATTTGG - Intergenic
952751372 3:36827545-36827567 TTCCCTAGGGGGAAAGGCTGGGG - Exonic
955660483 3:61293776-61293798 TTCCCTGAGGGGAAATGCCTGGG - Intergenic
955712869 3:61798506-61798528 TTCCTTTCAGGGAAATGTTTTGG - Intronic
956379271 3:68648730-68648752 TTCCCAAAGAGGAAATGGTAAGG + Intergenic
963209340 3:142671932-142671954 TTCCCTAGTGGGAAAAAGTTAGG - Intronic
968893367 4:3384698-3384720 TTCACTACTGGGAAGTGGGTTGG + Intronic
971909636 4:32778793-32778815 CTCCCTCCAGGGAAATGGTCAGG + Intergenic
974431597 4:61804846-61804868 TTCCTTGCGGGGAGAGGGTTGGG + Intronic
979531993 4:121778278-121778300 TTTTCTACTTGGAAATGGTTTGG - Intergenic
980831236 4:138131349-138131371 TTCCCTACAGGAAAATTGTTTGG - Intergenic
986535555 5:8783287-8783309 TTCCTTTGGGGAAAATGGTTGGG - Intergenic
989609203 5:43275418-43275440 TTGCCAAAGGTGAAATGGTTGGG + Intronic
990565185 5:57020913-57020935 CTCTCTAAGGGGAAATTGTTGGG + Intergenic
991237709 5:64418548-64418570 TTCCCTAAGGGCAAATGGTGAGG - Intergenic
992174569 5:74137032-74137054 TTACTTACAGGTAAATGGTTTGG - Intergenic
993437127 5:87911732-87911754 TTCTGTATGAGGAAATGGTTTGG - Intergenic
993479772 5:88410385-88410407 TTCTCTACGTCCAAATGGTTCGG - Intergenic
995125266 5:108572716-108572738 TTCTCTAAGAGGAAATTGTTGGG + Intergenic
999514653 5:152288799-152288821 TTCCCTAAGGAGAAATTCTTGGG - Intergenic
1000513641 5:162213415-162213437 TTCCCTATGGGGGAAAGGTCAGG + Intergenic
1002345856 5:178547136-178547158 TTCCCTACGGGGAAATAGTTTGG - Intronic
1004688650 6:17972862-17972884 TTCCCTTAGGGGAAAAAGTTTGG - Intronic
1007681314 6:43635663-43635685 TTCCCTGCTGGGCAAGGGTTAGG + Intronic
1017126635 6:151070829-151070851 TTCCCAATGAGGAAAAGGTTAGG - Intronic
1023254932 7:38303814-38303836 TTCCCTTGTGTGAAATGGTTTGG - Intergenic
1033291063 7:140083034-140083056 TGCCCCACGGGGCCATGGTTAGG + Intergenic
1033657800 7:143384817-143384839 GTCCAGAAGGGGAAATGGTTTGG + Intronic
1035791903 8:2314143-2314165 TTCCCTCAGGAGCAATGGTTTGG - Intergenic
1035800902 8:2407562-2407584 TTCCCTCAGGAGCAATGGTTTGG + Intergenic
1037675864 8:21050304-21050326 TTACCTAGGGGGTAATGTTTAGG - Intergenic
1053060035 9:35023548-35023570 TTCTCTAAGAGGAAATTGTTGGG + Intergenic
1053134096 9:35638473-35638495 TTCTCTAAGAGGAAATTGTTGGG - Intronic
1058930246 9:109711754-109711776 TTCCCTCCAGGGAAATCCTTCGG + Intronic
1060676298 9:125518203-125518225 TTTCCTACTGGTAAATGTTTAGG - Intronic
1062710516 9:137972771-137972793 TTCCGAACGGGGAGATGGTGCGG + Intronic
1186243706 X:7597790-7597812 TTCCCTGTGGGGAAGTGGTAGGG + Intergenic
1187912642 X:24125032-24125054 TTCTCTACGGGCATATTGTTGGG + Intergenic
1188201071 X:27293415-27293437 TTCTCTAAGAGGAAATAGTTGGG + Intergenic
1191959117 X:66680092-66680114 TTTCCAACTGGGAAGTGGTTGGG + Intergenic
1192570914 X:72203681-72203703 TTCCCTGTGGTGACATGGTTGGG - Intronic
1197891253 X:131272898-131272920 TTCCAAATGGGGAAATGGTGGGG - Intergenic
1200281883 X:154784065-154784087 TTTCCTACGAGGAAGTCGTTCGG - Exonic