ID: 907048719

View in Genome Browser
Species Human (GRCh38)
Location 1:51315568-51315590
Sequence GGTCTGAAAGGACCAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907048719_907048725 19 Left 907048719 1:51315568-51315590 CCACTTTCTGGTCCTTTCAGACC 0: 1
1: 0
2: 1
3: 25
4: 262
Right 907048725 1:51315610-51315632 TCCAGCCCAAGTTGCTTCTATGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907048719 Original CRISPR GGTCTGAAAGGACCAGAAAG TGG (reversed) Intronic
900380032 1:2379304-2379326 GTTCTGAAAAGACTAGAAAGTGG - Intronic
900705105 1:4075675-4075697 TGTCTGAAAGGAGCACAGAGTGG - Intergenic
900722323 1:4185295-4185317 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
901195344 1:7437046-7437068 GGTGGGACAGGAGCAGAAAGGGG + Intronic
902571396 1:17349192-17349214 GGACTGAAAGCAGCAGAAAGAGG - Intronic
903432983 1:23322926-23322948 GGTCTGAAATGAGCACCAAGTGG + Intronic
903592101 1:24464438-24464460 GGAATGAAATGATCAGAAAGGGG + Intronic
903702152 1:25257429-25257451 GGTCTGAAGGGAACAGGCAGAGG + Intronic
904576063 1:31505785-31505807 GGTCTCACAGGCCCAGAGAGGGG - Intergenic
905238272 1:36565384-36565406 GGGCTCCAAGGACCAGAAGGAGG - Intergenic
906056578 1:42922863-42922885 GGTCTGCAAAGGCCAGAATGTGG + Intergenic
907048719 1:51315568-51315590 GGTCTGAAAGGACCAGAAAGTGG - Intronic
907415389 1:54310777-54310799 TGTTTGAAAAGACCAGCAAGTGG - Intronic
907765449 1:57406034-57406056 GGTATGAATGGATCATAAAGTGG - Intronic
908000962 1:59678617-59678639 GGCCTGAAGGAAACAGAAAGTGG - Intronic
911248729 1:95550297-95550319 GGGCTGCAAGGACCAGACAAAGG - Intergenic
912863088 1:113232363-113232385 GGTTTGAAAGAATCAGAATGAGG + Intergenic
915038819 1:152950559-152950581 GACCTGAAAGGCGCAGAAAGAGG - Intergenic
915607851 1:156964815-156964837 GGTCTGAGAGCCCCAGAAGGTGG + Intronic
916173047 1:162015652-162015674 TATCTGAAAGAACCAGAAAGTGG + Intronic
916238553 1:162615106-162615128 CATCTGCAAGGACCAGAGAGCGG - Intergenic
916329040 1:163594302-163594324 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
918850953 1:189689554-189689576 TGACTGAAAGGAACAGAAAAGGG + Intergenic
920122572 1:203669735-203669757 AGTATGAAAGTCCCAGAAAGGGG - Intronic
920451949 1:206065947-206065969 GGACTAAAGGGACCAAAAAGAGG + Intronic
921432240 1:215079054-215079076 GATCTGAAAGCACCAGAATAAGG + Intronic
923225786 1:231937768-231937790 GGTAGGAAATGACCTGAAAGAGG + Intronic
923679034 1:236104216-236104238 GGTCTTAAAAGACCACAAAGCGG + Intergenic
924197009 1:241618640-241618662 GGTCAGCACGGACCAGAAATGGG - Intronic
924230366 1:241957571-241957593 GGTCTGTAAGGAGCTGAAGGAGG + Intergenic
1063213705 10:3904909-3904931 GTTCTTGAAGGCCCAGAAAGAGG + Intergenic
1063363381 10:5474764-5474786 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1064043434 10:11988893-11988915 GGTCTGGAAGAATCAGAAATGGG + Intronic
1065867334 10:29925506-29925528 GGTCTGAATGGAGCATAAAGCGG + Intergenic
1069629117 10:69887230-69887252 GGTGGGAAAGGAACAGGAAGGGG - Intronic
1069738210 10:70671389-70671411 CATCTTAAAAGACCAGAAAGAGG + Intergenic
1070285862 10:75083278-75083300 GGTAAGAAAGGAAAAGAAAGAGG - Intergenic
1070615609 10:77967267-77967289 GTTCAGAAAGGTTCAGAAAGTGG - Intergenic
1075313334 10:121432603-121432625 GATCTGAGAGGACCAGACTGGGG + Intergenic
1075919384 10:126197867-126197889 GGCCTGAAAGCCCCAGACAGCGG + Intronic
1076424620 10:130358868-130358890 GGTCTCAGAGGACAACAAAGAGG - Intergenic
1076606407 10:131692390-131692412 GGTAGAAAAGGACCAGAAAAGGG - Intergenic
1076705967 10:132301750-132301772 GGACTGAGAGGAACAGAAGGAGG + Intronic
1077589674 11:3481737-3481759 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
1077883578 11:6369459-6369481 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1078490954 11:11768144-11768166 GGTCTGTAAGCAGCAGTAAGGGG - Intergenic
1078822395 11:14895043-14895065 GTTCCCAAAGGCCCAGAAAGAGG - Intergenic
1079398289 11:20084877-20084899 GCTCTGAAGAGACCAAAAAGGGG + Intronic
1079847463 11:25489281-25489303 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
1080586546 11:33688022-33688044 GATGTGAGAGGACTAGAAAGGGG + Intergenic
1081322347 11:41706466-41706488 ATTCTGCAAGGACCAGAATGAGG + Intergenic
1083414674 11:62517819-62517841 GGTCTGAAAGGTTCAGAAGTAGG - Exonic
1084245393 11:67853511-67853533 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
1084354449 11:68627960-68627982 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1084653356 11:70501676-70501698 GGTCTGCAAGCAACAGAGAGAGG - Intronic
1084827293 11:71741067-71741089 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1085749244 11:79146215-79146237 GGTCAGAATAGCCCAGAAAGGGG + Intronic
1086134613 11:83433666-83433688 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
1088159103 11:106846939-106846961 AGTCTCAAGGGACCAAAAAGAGG + Intronic
1088555177 11:111053842-111053864 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1089264572 11:117250125-117250147 GGTATGAAAGCATCTGAAAGAGG + Intronic
1089678052 11:120103559-120103581 GGTCAGAAAAGAAGAGAAAGGGG + Intergenic
1092396459 12:8131507-8131529 GATCTGAATGGAACAAAAAGAGG - Intronic
1092415964 12:8290643-8290665 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
1092549922 12:9487192-9487214 GGTTGGAAAGAACCAGAAAAAGG + Intergenic
1093812611 12:23508087-23508109 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
1096150311 12:49305742-49305764 GTACTGAAAGGAACAGAGAGAGG - Intergenic
1097063659 12:56304369-56304391 CATTTGAAATGACCAGAAAGGGG + Intronic
1097541970 12:60954043-60954065 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
1098042707 12:66368483-66368505 GGGCTGAAAAGACCAGAGTGGGG - Intronic
1098437578 12:70484356-70484378 GGTCTGAAACTAGCAGAAATTGG - Intergenic
1100017140 12:90024553-90024575 GGGCTGACAGGGACAGAAAGGGG + Intergenic
1102548093 12:113671072-113671094 GGTGTGGCAGGACAAGAAAGTGG + Intergenic
1106956499 13:34943306-34943328 GGCAGGAGAGGACCAGAAAGAGG - Intronic
1108947662 13:56043961-56043983 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1109343821 13:61092179-61092201 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1110864009 13:80374727-80374749 GGGGCCAAAGGACCAGAAAGAGG + Intergenic
1112089259 13:96065360-96065382 GGTCCGAAGGGCTCAGAAAGGGG + Intergenic
1112368452 13:98774740-98774762 GGTGGGAAAGGACCACACAGAGG + Intergenic
1112780120 13:102891316-102891338 TGTCTGAAAGGAAAAGAAAAAGG - Intergenic
1113359268 13:109613924-109613946 GCAGTTAAAGGACCAGAAAGCGG + Intergenic
1116025537 14:39509855-39509877 GATTTGAAATTACCAGAAAGTGG - Intergenic
1116025856 14:39513704-39513726 GATTTGAAATTACCAGAAAGTGG + Intergenic
1116614719 14:47119978-47120000 GTTCTGAAATGACCAAATAGAGG - Intronic
1116681916 14:47982621-47982643 GGTCTGAAAGGAGCAAATATTGG + Intergenic
1117823599 14:59677123-59677145 GGTCAGAAAGCATCAGAAGGAGG - Intronic
1117957689 14:61135478-61135500 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
1118312297 14:64703207-64703229 GGTCTGGCAGGCCCAGAAAGCGG - Intergenic
1119520914 14:75284474-75284496 GGCGTTAAAGGTCCAGAAAGAGG + Intergenic
1119550974 14:75514004-75514026 TGTCTGAAAGGTGCAGGAAGAGG + Intergenic
1120728906 14:87979850-87979872 GGTCTGATAAGAGCAGTAAGGGG - Intronic
1121222605 14:92297900-92297922 GGTTTGAGAGGAAGAGAAAGAGG - Intergenic
1122738444 14:103856963-103856985 GGGCTGGAAGGAAGAGAAAGGGG + Intergenic
1124868085 15:33513757-33513779 GGACAGCAAGGACCAGAGAGTGG - Intronic
1126772268 15:52070278-52070300 GGTGAGAAAGGACCAGAAGCTGG - Intergenic
1127499739 15:59544861-59544883 GGGCAGAAAGCTCCAGAAAGAGG - Intergenic
1128109100 15:65065271-65065293 GGGCTGCAAGAAGCAGAAAGAGG + Exonic
1128667495 15:69549093-69549115 GGTTTGAAAGAAATAGAAAGAGG + Intergenic
1128691881 15:69730859-69730881 GTTCTGACAGGATCAGAAATAGG + Intergenic
1128704018 15:69825469-69825491 GGTCTGGATGGGCCAGAGAGGGG + Intergenic
1129945695 15:79537738-79537760 TTTCTGGGAGGACCAGAAAGTGG - Intergenic
1130781289 15:87043303-87043325 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1131690703 15:94824394-94824416 GGTCTGCGAGGGGCAGAAAGTGG + Intergenic
1131872835 15:96779091-96779113 GGTCCGAGATGACCTGAAAGTGG + Intergenic
1132823558 16:1890605-1890627 GGTCTGTGAGCAGCAGAAAGCGG - Intergenic
1133167017 16:3955037-3955059 GGGCTGAAAAGAAGAGAAAGTGG + Intronic
1134062314 16:11206511-11206533 GGGCGGACAGGACCAGGAAGTGG + Intergenic
1134207888 16:12252671-12252693 GGGCTGCCAGGACCAGAAGGAGG - Intronic
1134594335 16:15483748-15483770 AGTATGCAAGGGCCAGAAAGGGG - Intronic
1134868932 16:17634072-17634094 GATCTTAAAGGACCAGGATGGGG + Intergenic
1135098705 16:19587162-19587184 TGTCTGACAGGAACAGCAAGGGG + Intronic
1135912775 16:26576733-26576755 GGTCTGAATAGAGCAAAAAGTGG - Intergenic
1137427564 16:48392390-48392412 GGTCAGAGAGACCCAGAAAGGGG + Intronic
1138365473 16:56472826-56472848 GATGTAAAAGGATCAGAAAGAGG - Intronic
1138407659 16:56810745-56810767 GACCAGAAAGGACCACAAAGAGG - Intronic
1138407667 16:56810785-56810807 GACCAGAAAGGACCACAAAGAGG - Intronic
1139289934 16:65848762-65848784 TGTCTGCAAGGCCCAGAAATTGG - Intergenic
1140935070 16:79662777-79662799 TGGCTGAAAGGGCCAGAAAGTGG + Intergenic
1142395749 16:89830231-89830253 GGGCTGTGAGGACCAGGAAGGGG - Intronic
1143023285 17:3927614-3927636 GGCCAGAAAGAACCAGACAGGGG + Intronic
1143405021 17:6671561-6671583 GGTCTGAAAGAGCCAGAAAGTGG + Intergenic
1143416736 17:6756179-6756201 TTTCTGAAGGGAGCAGAAAGTGG + Intronic
1147177851 17:38667685-38667707 TGTCTGCTAGCACCAGAAAGAGG - Intergenic
1147571490 17:41573896-41573918 GGTCAGCAAGGGCCTGAAAGAGG + Intergenic
1150431706 17:65123369-65123391 TGTCTGAAAGAAGCCGAAAGTGG + Intergenic
1151726563 17:75888511-75888533 GCTCTGAAAGGGGCAGAGAGAGG - Intronic
1152309159 17:79538653-79538675 GGTCTGAAGGAACCACACAGTGG - Intergenic
1153641184 18:7158506-7158528 TATCTGAAAGGAGGAGAAAGAGG - Intergenic
1155548288 18:26938331-26938353 GGACTGAAAGGATCGAAAAGTGG - Intronic
1155914705 18:31544956-31544978 GGTTAAAAAGGAGCAGAAAGTGG - Intronic
1156282470 18:35653470-35653492 GCCCTGGAAGGACCAGAATGTGG - Intronic
1156474071 18:37394712-37394734 GGACTGAAGGGTCCAGAAGGAGG + Intronic
1157297263 18:46455349-46455371 GGTGTGAAGGGACCAGAAAAGGG + Intronic
1158797038 18:60858842-60858864 AGTATAAAAGGAACAGAAAGAGG + Intergenic
1159616968 18:70592228-70592250 TGTCTTAAAGGACCTGAAAAAGG - Intergenic
1160211374 18:76883083-76883105 GGTCTGGAAGGAGCAGCACGGGG - Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161708773 19:5835277-5835299 GGGCTGCAAGGAACAGAGAGGGG - Intronic
1162028719 19:7908363-7908385 GGGCTGGCAGGACCAGATAGGGG + Intronic
1162690749 19:12428247-12428269 GGCCTGACAGCACCAGAAAAAGG - Intronic
1164905109 19:31960794-31960816 GGACTCAAAGGGCCAGAGAGAGG + Intergenic
1165452559 19:35892835-35892857 TGTCTAAAAGTACAAGAAAGTGG + Intronic
1166374902 19:42322224-42322246 AGTCAGAAAGGGACAGAAAGAGG + Intronic
926838539 2:17051907-17051929 GCTCTGACAGGACCAAAAACTGG - Intergenic
926985080 2:18613644-18613666 GGTCTGAATAGACCAAAAAGGGG + Intergenic
930245578 2:48980104-48980126 GATCTGAAAGCCCCAGAAAGGGG + Intronic
933645877 2:84812321-84812343 AGTCTGAAAGAACAAAAAAGGGG - Exonic
934964401 2:98707488-98707510 GTTATTAAAGGACGAGAAAGTGG - Intronic
935342627 2:102071529-102071551 TGGCTGAAAGTATCAGAAAGTGG + Intronic
938992840 2:136647126-136647148 GGTATGAAAGAATCAGAAAAAGG - Intergenic
939004603 2:136771477-136771499 GGTCTAAAAGAAGAAGAAAGTGG - Intronic
941455945 2:165712390-165712412 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
943111733 2:183615147-183615169 GGTATGAAAGAACCAGACTGTGG - Intergenic
944394903 2:199255546-199255568 GGCCTGAAAGGGCCAGGGAGTGG - Intergenic
945279395 2:208021743-208021765 GGGCTGAAAGGGCCACAACGGGG - Intronic
946073092 2:217051085-217051107 GTTCTAAAAGGATCAGAGAGAGG + Intergenic
946696431 2:222364579-222364601 GGTATGAAAGGGACAGCAAGGGG - Intergenic
948095914 2:235334088-235334110 GTTCAGAAAGGACCAGAGGGAGG - Intergenic
948978927 2:241482758-241482780 TGTCTGAAAGGAACAGATGGTGG + Intronic
1169123591 20:3111705-3111727 GCTCTGAAAGCACAGGAAAGGGG - Intronic
1170236001 20:14105850-14105872 GGCCTGTTAGGGCCAGAAAGGGG - Intronic
1170948507 20:20912890-20912912 GGTCTGGAAGGAGAAGAAAAGGG + Intergenic
1172754018 20:37270864-37270886 GGTGGGAAAGGCCCAGAGAGTGG - Intergenic
1173652294 20:44674180-44674202 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1174076879 20:47943661-47943683 GGTCAGAAATGAACAGAAGGAGG - Intergenic
1174897256 20:54462786-54462808 GGTCTGAATTGAGCAGAAATTGG + Intergenic
1175055676 20:56195428-56195450 GGCCTGAAAAGAACAGAAAGGGG - Intergenic
1175278687 20:57788392-57788414 GGCCTTCAAGGAACAGAAAGAGG - Intergenic
1178763023 21:35422221-35422243 GGTCTGAACACTCCAGAAAGTGG - Intronic
1180739712 22:18044654-18044676 GGTGTGAAAAGCCCAGAAATAGG + Intergenic
1181329736 22:22080612-22080634 AGTCTGAAAGGACCAGATGAAGG + Intergenic
1181623546 22:24106974-24106996 GATCTGAAAGGAGCAGAAAATGG + Intronic
1183716854 22:39538188-39538210 GGTCTGGAAGGATCAGAAGATGG - Intergenic
950003957 3:9679426-9679448 TGCCGGAAGGGACCAGAAAGAGG - Intronic
950563054 3:13746885-13746907 GGTCTGAAAAGGCCGGTAAGGGG + Intergenic
952863355 3:37833240-37833262 AGTCTGAAAGGACCACGCAGAGG + Intergenic
952894972 3:38072557-38072579 TGTCTTCAAGGAACAGAAAGAGG + Intronic
954974362 3:54679085-54679107 GGTCTTAAAGGGCAAGAGAGGGG - Intronic
955302417 3:57794589-57794611 GGTCTGAAGGGAGGAGAAAATGG - Intronic
956233278 3:67040748-67040770 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
956709439 3:72026644-72026666 TGTCTTGAAGGAACAGAAAGAGG - Intergenic
957059695 3:75472131-75472153 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
958744728 3:98118916-98118938 CATCTCAAAGGACCAGAAAGTGG + Intergenic
960528043 3:118732826-118732848 GGTCTGAGAGGAAAACAAAGAGG + Intergenic
961236464 3:125372423-125372445 GGTCAGAAAGGAGGAGAAAGGGG + Intronic
961893514 3:130149256-130149278 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
962660859 3:137599132-137599154 TGTCTTCAAGGACAAGAAAGAGG - Intergenic
965639787 3:170819852-170819874 TGTCTTCAAGGAACAGAAAGAGG + Intronic
965861764 3:173158014-173158036 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
967067329 3:185930432-185930454 GGCCTGAAAGCATCAGAAAATGG + Intronic
967624431 3:191668542-191668564 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
969003600 4:4002317-4002339 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
969653831 4:8484675-8484697 TGTCTTCAAGGAACAGAAAGAGG + Intronic
969749258 4:9097869-9097891 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
969810324 4:9642506-9642528 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
970231463 4:13915492-13915514 GGAGGCAAAGGACCAGAAAGAGG - Intergenic
970909977 4:21263589-21263611 GCTCTGGCAGGAACAGAAAGTGG - Intronic
971295580 4:25386864-25386886 AGTATGAAATGACTAGAAAGAGG - Intronic
973951092 4:56015206-56015228 TGACTGAAAGGAACAGAAATGGG + Intronic
974823108 4:67093065-67093087 GGTGTGAAATGAGCAGAGAGAGG + Intergenic
975489433 4:74972372-74972394 ATTCTGAAAGAAACAGAAAGCGG - Intronic
976946817 4:90780583-90780605 AGTCTGAAAGGAAAAGAAATAGG + Intronic
979171186 4:117602371-117602393 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
979596788 4:122543192-122543214 GTTCTTAAAGGATGAGAAAGAGG - Intergenic
983883540 4:172958424-172958446 TGTCTTCAAGGAACAGAAAGAGG + Intronic
985057179 4:186046258-186046280 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
985435933 4:189929508-189929530 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
986554826 5:9000602-9000624 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
993281304 5:85928254-85928276 GGCCTTAAAGGAGCAGAAAGTGG + Intergenic
993501083 5:88667589-88667611 GGTCTGAAAGAAGGAGAAAAGGG + Intergenic
994425928 5:99587134-99587156 GGACTGAAAGGAACAGAGATGGG + Intergenic
994607123 5:101982175-101982197 GATCTGTAAGGATCAGAAAGAGG + Intergenic
997241881 5:132313809-132313831 CCTCTGAAAGGCCCAGAAAGAGG + Intronic
997881659 5:137597456-137597478 TGTCTAAAATGCCCAGAAAGTGG - Intronic
998693480 5:144613409-144613431 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
998885700 5:146691710-146691732 GGTCAGAAAGGTGGAGAAAGTGG - Intronic
999768497 5:154757248-154757270 GGTCCAAAAGGACCAAAACGCGG - Intronic
999890955 5:155978146-155978168 TCTCTGAAAAGACCAGAATGTGG + Intronic
1001354048 5:171003282-171003304 TGTCTTCAAGGAACAGAAAGAGG + Intronic
1001944948 5:175770983-175771005 GGTCTCAAGGGACCAGAAGAAGG - Intergenic
1002432357 5:179210939-179210961 GGTCTGCAAGGGCCAGCATGTGG - Intronic
1004837225 6:19542557-19542579 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1005723774 6:28629015-28629037 GGTCTGAATAGAACAGAAGGAGG - Intergenic
1005758110 6:28943751-28943773 GGAATGAAAGGACTGGAAAGGGG - Intergenic
1006109058 6:31733998-31734020 GGTCAGGAAGAACCAGAAAGGGG + Intronic
1006389116 6:33748230-33748252 GGTCTGGAGGGACCAGAAGATGG - Intergenic
1006910710 6:37561712-37561734 GGTCTTTCAGGCCCAGAAAGGGG + Intergenic
1006910940 6:37563298-37563320 GGTCTTTCAGGCCCAGAAAGGGG - Intergenic
1007257470 6:40538969-40538991 GGTGTGAAAAGACCAGAACAGGG - Intronic
1007275121 6:40667639-40667661 GGACTGAAAGGAACAGACAGGGG - Intergenic
1008640435 6:53456886-53456908 GGTCAGAAAGGACCAGACACAGG - Intergenic
1014404050 6:121026340-121026362 GGAATGAAAGGACCAGAACAGGG - Intergenic
1015163596 6:130179175-130179197 TGTCTGATAGGAACAGAAAAAGG + Intronic
1015801161 6:137063381-137063403 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
1016983577 6:149876680-149876702 TGGCTGGAAAGACCAGAAAGTGG + Intergenic
1017019782 6:150130862-150130884 GGTCTGGGAGGAGCAGGAAGAGG + Intergenic
1019088830 6:169507236-169507258 GGTCAAAAAGGACAGGAAAGGGG - Intronic
1020323737 7:6958771-6958793 TGTCTTCAAGGAACAGAAAGGGG + Intergenic
1020559552 7:9713618-9713640 AGTCTGATAGGTACAGAAAGAGG + Intergenic
1020794451 7:12663353-12663375 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1020871588 7:13637039-13637061 GGTTTGGAAGGAGCATAAAGGGG + Intergenic
1021533425 7:21675155-21675177 GTGCTGAAAGGTCTAGAAAGTGG - Intronic
1022251268 7:28610748-28610770 GGCCTGGAAGGTCCAGGAAGTGG + Intronic
1026840651 7:73668415-73668437 GTTCTGTAAGGGCCAGAAAGAGG + Intronic
1027424196 7:78046085-78046107 GGCCTAAAAGGACCAGAAATAGG + Intronic
1028046708 7:86129577-86129599 GGTCTTATAATACCAGAAAGTGG - Intergenic
1028651516 7:93155380-93155402 GAACTAAAAGGAGCAGAAAGAGG - Intergenic
1030612952 7:111708523-111708545 CCTCTGAAAGGAACAGGAAGAGG - Intergenic
1031107445 7:117562556-117562578 TGTCTGAAAGGGACATAAAGTGG - Intronic
1034282590 7:149864386-149864408 GGTCTCTAAGCACCAGGAAGTGG + Exonic
1036372325 8:8172213-8172235 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1036878577 8:12493428-12493450 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
1037049132 8:14347959-14347981 GGTGGGAAAGGAAGAGAAAGAGG - Intronic
1037733176 8:21546470-21546492 GAGCTGACAGGACCAGGAAGAGG - Intergenic
1038597528 8:28902434-28902456 GTTTTGATAGGATCAGAAAGAGG + Intronic
1039384867 8:37126513-37126535 GGTCTGAATAGATCAAAAAGGGG - Intergenic
1039719947 8:40152511-40152533 TTTCTTAAAGGACTAGAAAGCGG + Intergenic
1041179968 8:55236886-55236908 TGACTGAAAACACCAGAAAGAGG - Intronic
1041861370 8:62516953-62516975 TGTCTGGAAGGAGCTGAAAGTGG - Intronic
1042050031 8:64693640-64693662 GGTGAGAAAGGACCATAAAATGG + Intronic
1042158868 8:65871892-65871914 GGTTTGAAAGTCCCAGAAACTGG + Intergenic
1044596160 8:93960919-93960941 GGTGAGAAAGGATCAGGAAGGGG - Intergenic
1046397374 8:113657654-113657676 TGTCTGAAAGGACCACCAGGAGG + Intergenic
1051604841 9:18908847-18908869 GGTCTCAAAGACCTAGAAAGAGG + Exonic
1051726075 9:20089180-20089202 AGTCTGCAGGGACCAGAAACTGG + Intergenic
1053008421 9:34619901-34619923 GGTCTGAAAGGACCAGGATTAGG - Intronic
1055151610 9:73007318-73007340 GGACTGAAAAGAAGAGAAAGTGG - Intronic
1055998417 9:82188184-82188206 GATCCAAAAGAACCAGAAAGAGG - Intergenic
1056192254 9:84195896-84195918 GCTCTGAAAAGACATGAAAGAGG + Intergenic
1056259335 9:84832473-84832495 GTCCTGAAAGGAGCAGTAAGAGG + Intronic
1057158403 9:92866149-92866171 GGGCTGATAGGAAAAGAAAGAGG + Intronic
1058220527 9:102294814-102294836 AGTCTGAAAGCATCAGAAACAGG - Intergenic
1058612619 9:106791997-106792019 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1058958077 9:109967791-109967813 GCTCTGGGAGGAACAGAAAGTGG + Intronic
1060163003 9:121383939-121383961 GAGCTGAAAGGATCAGAAAGAGG + Intergenic
1060503453 9:124180621-124180643 GGACTCAGAGGACCAGGAAGAGG - Intergenic
1061344017 9:130007444-130007466 GTTCTGAAATGAAGAGAAAGGGG + Intronic
1186439357 X:9572195-9572217 AAACTGAAAGGAACAGAAAGAGG - Intronic
1187076096 X:15936762-15936784 GAACTGAAAGGACCATAAATAGG - Intergenic
1190871091 X:54425293-54425315 TGTCTGCAAGTAACAGAAAGTGG + Intergenic
1191737826 X:64406005-64406027 GGACAGAAAGGAACAGAAGGAGG + Intergenic
1192545164 X:72006947-72006969 AGTGTGAATGGACAAGAAAGTGG + Intergenic
1194467361 X:94250113-94250135 GGACATAAAGGAACAGAAAGAGG - Intergenic
1194873574 X:99161489-99161511 TGTCTTCAAGGAACAGAAAGAGG + Intergenic
1194968199 X:100313772-100313794 GGTTGGAAAGGACAAGAAAGAGG + Intronic
1197499934 X:127230244-127230266 TGTCTTCAAGGAACAGAAAGAGG - Intergenic
1198921894 X:141738377-141738399 TATCTGAGAGGAGCAGAAAGTGG - Intergenic
1201718465 Y:17072297-17072319 GGTATGAGAGGGCCAGGAAGAGG + Intergenic
1202076295 Y:21040979-21041001 TGTCTTCAAGGAACAGAAAGAGG + Intergenic