ID: 907049663

View in Genome Browser
Species Human (GRCh38)
Location 1:51321685-51321707
Sequence GCACACCCCCTACCCCAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907049657_907049663 15 Left 907049657 1:51321647-51321669 CCTCTCATACAAGACCTCTGGTT 0: 1
1: 0
2: 0
3: 7
4: 90
Right 907049663 1:51321685-51321707 GCACACCCCCTACCCCAACCGGG 0: 1
1: 0
2: 0
3: 29
4: 284
907049659_907049663 -10 Left 907049659 1:51321672-51321694 CCCTGACCGTCATGCACACCCCC 0: 1
1: 0
2: 0
3: 4
4: 134
Right 907049663 1:51321685-51321707 GCACACCCCCTACCCCAACCGGG 0: 1
1: 0
2: 0
3: 29
4: 284
907049658_907049663 1 Left 907049658 1:51321661-51321683 CCTCTGGTTCTCCCTGACCGTCA 0: 1
1: 0
2: 0
3: 9
4: 139
Right 907049663 1:51321685-51321707 GCACACCCCCTACCCCAACCGGG 0: 1
1: 0
2: 0
3: 29
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907049663 Original CRISPR GCACACCCCCTACCCCAACC GGG Intronic
900714873 1:4137872-4137894 GCAGACCCCCTCCCCAGACCTGG - Intergenic
901066720 1:6497699-6497721 GCAGAGCCCCCACCCCAGCCCGG + Intronic
901898970 1:12341710-12341732 GCAGAGACCCTCCCCCAACCTGG - Intronic
902542971 1:17167312-17167334 GCCCCCCCCCCGCCCCAACCTGG + Intergenic
903278624 1:22237349-22237371 GCACACACCCTGACCCACCCAGG - Intergenic
903961224 1:27059056-27059078 GGACACCCCCTCCCCCAGGCTGG + Intergenic
904264505 1:29310637-29310659 GCAGAACCCCTACCCCACCAGGG - Intronic
904273801 1:29367434-29367456 TCACACCCCCACCCCCACCCAGG + Intergenic
904618806 1:31763635-31763657 GCCCCCCCCCTCCCCCAGCCTGG - Intronic
905530582 1:38675551-38675573 GCTCACCCCCTGCACCATCCTGG + Intergenic
906014562 1:42563449-42563471 CCTCACCCCCTACCCCCAACAGG - Intronic
906519522 1:46458878-46458900 GCTCACCCCCACCCCCAGCCAGG - Intergenic
907049663 1:51321685-51321707 GCACACCCCCTACCCCAACCGGG + Intronic
907054036 1:51348547-51348569 GTACAGCCTCTACCCCATCCAGG + Intergenic
907416604 1:54318738-54318760 CCACATCCCCCACCCCAAGCCGG + Intronic
909003069 1:70242369-70242391 CCACACCCCACACCCCCACCAGG + Intronic
910374371 1:86552770-86552792 GGACAGCCCCTACTACAACCTGG - Intronic
912605184 1:110982478-110982500 TCACAACCGCTACACCAACCTGG - Intergenic
913363117 1:118004521-118004543 GCGGACCCCCTCCCCCAGCCAGG + Intronic
914196498 1:145450653-145450675 GCTCAGCCCCGACCCCACCCTGG + Intergenic
915466545 1:156101763-156101785 GCTCACCACCAACCCCCACCTGG - Intronic
915514782 1:156406396-156406418 GCACTCCTCCTCCCCCACCCAGG - Intronic
916088532 1:161289059-161289081 CCACCCCCCCAACCCCCACCAGG - Intergenic
916517013 1:165527817-165527839 TCACACCCCCAACCCCAATCAGG + Intergenic
917071211 1:171152714-171152736 GCACACCTCCAACCCTCACCAGG - Intronic
917726572 1:177833481-177833503 CCAAACCCCCTACCCCAGACAGG + Intergenic
918122493 1:181551602-181551624 GCACACCCCTTCCCCCACCAAGG - Intronic
921837746 1:219795198-219795220 GTTCACCCCCCAACCCAACCTGG - Intronic
922620014 1:226983468-226983490 GCACTCCCCCAACCCCCAACTGG - Intronic
923231457 1:231990377-231990399 GCTCATCCCCCACCCCACCCAGG + Intronic
1065818339 10:29501936-29501958 CCACACCCACTACCCCACCCTGG - Intronic
1065954573 10:30682568-30682590 CCACACCCACTACCCCACCCCGG + Intergenic
1067090438 10:43263671-43263693 GCTCAGCCCCTACCCCAGCCCGG + Intronic
1067178944 10:43970619-43970641 GCACACTCTCTGCCCCACCCTGG + Intergenic
1067273961 10:44818466-44818488 GCACACACCCTGACCCAGCCTGG + Intergenic
1069605311 10:69735311-69735333 GCTCGCCCCCCACCCCCACCAGG - Intergenic
1069845409 10:71367572-71367594 GCACACCCCCTACTGCCACCAGG + Intergenic
1069859133 10:71459635-71459657 GCCCACCTCCTAGCCTAACCAGG + Intronic
1069899367 10:71698367-71698389 CCACAGACCCTACCTCAACCTGG - Intronic
1070523848 10:77277703-77277725 CCACTCCCACTGCCCCAACCTGG + Intronic
1070797414 10:79224663-79224685 GCAGATCCCCTATCCCAATCAGG - Intronic
1073028896 10:100508977-100508999 GCACCCCCACTACCCAACCCTGG - Intronic
1076829913 10:132988991-132989013 GCACCCCCCCCCCCCCCACCGGG - Intergenic
1077272495 11:1687945-1687967 GCACAGCCCTTACCACGACCTGG - Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1081623818 11:44634871-44634893 GCACAGCCCCTCCCCCACCCAGG - Intergenic
1083291255 11:61691534-61691556 GGACCCCCCCCAACCCAACCTGG + Intronic
1083340513 11:61955851-61955873 GCTCATCCGCTACGCCAACCTGG + Exonic
1083366355 11:62143795-62143817 CCACACCCATCACCCCAACCTGG - Intronic
1083696753 11:64448584-64448606 ATTCACCCCCTCCCCCAACCTGG - Intergenic
1083724971 11:64623260-64623282 CCACAGCCCCTAGCCCAGCCAGG + Intronic
1084661125 11:70546993-70547015 GCTCACCTCCCACCCCCACCTGG + Intronic
1084944526 11:72631631-72631653 GGAGCCCCCCTACCCCAGCCTGG + Intronic
1085015400 11:73170442-73170464 GCAATCCTCCTACCCCAGCCAGG - Intergenic
1085297618 11:75439809-75439831 GCCCAGCCCCCACCCCAGCCAGG - Intronic
1085508377 11:77073020-77073042 ACACAGCCCCCACCCCACCCCGG + Intronic
1087243967 11:95812516-95812538 CCACACTCCCCACCCCACCCGGG + Intronic
1088401168 11:109423508-109423530 GCACACCCCCTCCCGCTACAGGG + Exonic
1088704880 11:112453248-112453270 TCATACCCCCAGCCCCAACCAGG + Intergenic
1088827518 11:113508122-113508144 GTCCACCCCCCACCCCACCCAGG - Intergenic
1088916255 11:114230075-114230097 ACACACCCACTGCCCCAACCTGG - Intronic
1089335643 11:117721392-117721414 AGTCACCCCCTCCCCCAACCTGG + Intronic
1089682614 11:120127670-120127692 GCATTCCCACTGCCCCAACCTGG + Intronic
1089729848 11:120512716-120512738 GCACGCCCTCCACCCCAGCCAGG - Intronic
1089983879 11:122794854-122794876 TCACACCCCCAACTCTAACCAGG + Intronic
1090389691 11:126381058-126381080 GCACAGCCCCTCCCCAACCCGGG + Intronic
1091184642 11:133636769-133636791 GCCCCCCCCCCACCCCCACCGGG + Intergenic
1096183816 12:49565689-49565711 GAACACTCCTTACCCCACCCTGG + Intronic
1096259676 12:50082859-50082881 CCTCACCCTCTCCCCCAACCCGG + Exonic
1096445991 12:51692266-51692288 GCACTCACCCACCCCCAACCTGG + Intronic
1096802672 12:54121740-54121762 ACCCATCCCCTACCCCAATCAGG + Intergenic
1098617956 12:72553731-72553753 CCACACCCCCCACCCCACCCAGG + Intronic
1100832825 12:98533415-98533437 GCAAACTACCTACCCCACCCTGG - Exonic
1102678347 12:114673508-114673530 CCCCACCCCCAACCCCAAGCAGG - Intronic
1108130764 13:47297645-47297667 CCTCGCCCCCTACCCCAAACTGG - Intergenic
1108421183 13:50251343-50251365 TCACTCCCCCGACCCCAACAAGG - Intronic
1112332816 13:98489687-98489709 ACACACCCCCTGCCCCAGGCTGG - Intronic
1112727212 13:102318323-102318345 GCACCCACCCTACCCAAACTGGG + Intronic
1112900419 13:104351487-104351509 GCACCCACCCCACCCCACCCTGG + Intergenic
1115436447 14:33380341-33380363 GCACCCCTCCTCCCCCAAGCAGG - Intronic
1118137621 14:63046085-63046107 GCACCGCCCTTACCCCACCCCGG + Intronic
1119217715 14:72881800-72881822 GCAGACCCCCTTCCCCCAGCTGG - Intronic
1119293605 14:73515817-73515839 GCACACACCCTACCCCAGAAAGG - Intronic
1119293669 14:73516292-73516314 GCACACACCCTACCCCAGAAAGG - Intronic
1120855441 14:89207987-89208009 AGACTCCCCCAACCCCAACCAGG - Intronic
1121273603 14:92653179-92653201 GCCCACCCCCTATCCCTTCCTGG + Intronic
1122280891 14:100621939-100621961 CCACACCCCCAGCCCCAACTAGG + Intergenic
1122314595 14:100818270-100818292 GCAGAGTCCCCACCCCAACCAGG + Intergenic
1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG + Intronic
1122945981 14:105009715-105009737 GGACACCCCCAACTCCAGCCGGG + Exonic
1123129252 14:105972343-105972365 GCCCACCCCCTGCCCCGCCCTGG - Intergenic
1126098170 15:45103947-45103969 GCACACCCCATACCGCATCATGG + Exonic
1128804553 15:70521225-70521247 GCTCACCCCCAACCCCCACAGGG - Intergenic
1131249041 15:90819009-90819031 GTACACAGCCCACCCCAACCAGG - Intergenic
1131281341 15:91023767-91023789 GCAACCCCCCGACCCCGACCTGG - Intergenic
1131829862 15:96347329-96347351 GCGCACCCCCACCCCCAACCAGG - Intergenic
1132522399 16:397651-397673 CCACACCCCCACCCCCACCCCGG - Intronic
1132666411 16:1083107-1083129 CCGCACCCCCCACCCCCACCGGG - Intergenic
1132877703 16:2147809-2147831 GCAGACCCACCTCCCCAACCTGG - Intronic
1132956597 16:2597586-2597608 CCAAAACCCCCACCCCAACCTGG - Intronic
1134085854 16:11357009-11357031 GCACTCTCCCCACCCCCACCTGG - Intergenic
1134086647 16:11362048-11362070 GCATTGCCCCTACCCCCACCAGG + Intronic
1137861184 16:51848587-51848609 GCACACCCCCCACCCCACTTTGG - Intergenic
1139494040 16:67303110-67303132 GCCCGCCCCCCACCCCACCCCGG + Intronic
1139590694 16:67931313-67931335 GCACTACCCCTTCCCCAACAGGG + Intronic
1139822976 16:69735405-69735427 GCACACCGTGTACCCCAAGCTGG + Intergenic
1140517037 16:75550757-75550779 GCACCACCCATACTCCAACCTGG - Intronic
1140880250 16:79191697-79191719 AAATACCACCTACCCCAACCTGG + Intronic
1140959337 16:79897156-79897178 GCACACACCCTCTCCCAACAGGG + Intergenic
1142195150 16:88736162-88736184 GCACACCCGCTACCCCTGTCTGG - Exonic
1143495959 17:7312711-7312733 CCACACCCCCCACCCCATCGTGG - Exonic
1143518925 17:7434770-7434792 GCACCCCCCCCACCCCACCCAGG + Intergenic
1143947371 17:10605159-10605181 GCCCACCCCCACCCCCAAACTGG + Intergenic
1144750124 17:17642729-17642751 CCCCACCCCCACCCCCAACCTGG + Intergenic
1144957636 17:19027173-19027195 CCACAGCCCCTAGCCCAGCCAGG - Intronic
1144977520 17:19147343-19147365 CCACAGCCCCTAGCCCAGCCAGG + Intronic
1146062381 17:29614085-29614107 GCCCAGCCCCTCCCCCACCCCGG + Exonic
1146367233 17:32238621-32238643 TCACACCACCTACTCCAGCCTGG + Intronic
1147393137 17:40122227-40122249 GCACCCCCCCTTCCCCGCCCCGG - Intergenic
1148495455 17:48050990-48051012 TCAAACCCCGTACCCCACCCTGG - Exonic
1150814090 17:68378918-68378940 CCCCACCCCCGACCCCAAACTGG - Intronic
1152281400 17:79386744-79386766 CCCCACCCCCTACTCCAAGCAGG + Intronic
1152356614 17:79810589-79810611 ACGCACCCCCTCCCCAAACCCGG + Intergenic
1153051363 18:905760-905782 GAACCCCCCCTCCCCCAACCCGG + Intronic
1153227870 18:2911602-2911624 GGAGAGCCCCTACCCCAACTAGG - Intronic
1153392535 18:4578566-4578588 GCACACCCCTCACCCCTTCCTGG - Intergenic
1153607312 18:6847269-6847291 GCACACCCCCACCCCTAACAAGG + Intronic
1158800134 18:60896547-60896569 GCACACACCCTCCCCCAACATGG + Intergenic
1160497334 18:79383223-79383245 GCACACCCCCTGCCCCGGCTGGG - Intergenic
1161065446 19:2235382-2235404 TCACTCCTCCTACCCCCACCTGG + Intronic
1161070160 19:2255936-2255958 GAAGACCCCCAACCACAACCGGG - Intronic
1161466435 19:4433209-4433231 GCACACCCCCACCCCCAGCGAGG + Exonic
1161487515 19:4543882-4543904 GCTCACCCCCCACGCCAGCCCGG - Exonic
1161766178 19:6210221-6210243 TCACACTCCCCACCCCCACCAGG + Intergenic
1161937725 19:7382448-7382470 TCACGCCCCCCACCCCCACCCGG - Intronic
1162308310 19:9889149-9889171 GCACACCCCCTCCCCTCTCCAGG - Intronic
1162407868 19:10486417-10486439 CCACACCCCCTTTCCCAGCCAGG + Exonic
1162718765 19:12649424-12649446 GCTCACCCCCAACCCCAGGCGGG - Exonic
1162927678 19:13938348-13938370 GCCCACCCCCTTCCCCGCCCTGG + Exonic
1163124321 19:15236589-15236611 GCACACCCTCCACCTCAGCCAGG + Exonic
1163418494 19:17201339-17201361 GCCCACCCCCCACCCCCACGGGG - Intronic
1163570836 19:18081419-18081441 GTACACCTCCTCCCCCAGCCTGG + Intronic
1165136551 19:33673422-33673444 CCACTCCCCCTGCCCCACCCAGG - Intronic
1165907973 19:39205060-39205082 CCCCACCCCCCACCCCCACCAGG + Intergenic
1166321351 19:42021224-42021246 CCACAGCCCCAACCCCATCCAGG + Intronic
1167003010 19:46756887-46756909 GAACCCCCAGTACCCCAACCCGG + Exonic
1167755735 19:51412260-51412282 CAACACCCCCCACCCCACCCCGG - Intronic
925594253 2:5539696-5539718 GCACACCCCCAACCCCCAGCAGG + Intergenic
925738976 2:6988582-6988604 CCACACCCCTCACCCCCACCAGG - Intronic
926103512 2:10136147-10136169 GACCACACCCTACCCCATCCAGG - Intergenic
926419857 2:12685821-12685843 GCACACCCTCCTCTCCAACCTGG + Intergenic
926797778 2:16632958-16632980 GCACACCCTCCACCCCAATGAGG + Intronic
927997258 2:27494956-27494978 GCGCTGCCCCTACCCCATCCCGG + Exonic
928376990 2:30783378-30783400 GCCCTCCCCCTCCCCCAGCCAGG - Intronic
930089496 2:47521380-47521402 GCACGCCGCCTACCGGAACCAGG - Exonic
931340650 2:61397989-61398011 GCAACCCCCCTCCCCCAAGCGGG - Intronic
932732891 2:74232989-74233011 GGTCACCCCCTCCCCCATCCAGG - Intronic
934033240 2:88066459-88066481 CCCCACCCCCAACCCCCACCAGG + Intergenic
934113511 2:88764368-88764390 GCCCACCCCTTCCCCCAACCAGG + Intergenic
935894636 2:107721436-107721458 GTACACCCCATACCCCAATGAGG - Intergenic
937136725 2:119559830-119559852 ACACACCCCCCACCCCACACAGG - Intronic
937377539 2:121347942-121347964 CCCCACCCCCCACCCCAACCTGG + Intronic
938066566 2:128284879-128284901 GCAGACCCCCACCCCCCACCTGG + Intronic
942587467 2:177498329-177498351 GCACACCCCCCACCACCACCTGG - Intronic
942604850 2:177679820-177679842 CCTCGCCCCTTACCCCAACCTGG - Intronic
945207030 2:207343178-207343200 GTGCTCCCCCTACCCCCACCAGG - Intergenic
945285570 2:208078268-208078290 CCACACCCCCTCCCCCAAGGTGG + Intergenic
946051881 2:216869629-216869651 CCCCATCCCCAACCCCAACCTGG + Intergenic
947799728 2:232921273-232921295 GCAACCCCCCAACCCCAACATGG - Intronic
948207095 2:236168135-236168157 GCACACCCCCTGCACCCGCCCGG - Exonic
948486931 2:238287415-238287437 GCCCACCCTCTACCCCCACCTGG - Intronic
948942652 2:241203951-241203973 GCACCCTCCCTTCCCCATCCTGG + Intronic
1168795800 20:609660-609682 GCCCCCCGCCTACCCCGACCTGG + Intronic
1168945209 20:1748672-1748694 ATACACCCCCCGCCCCAACCGGG + Intergenic
1169060961 20:2660074-2660096 CCACACCAGCTCCCCCAACCAGG + Exonic
1171905228 20:30894398-30894420 GGCCACCCCCTGCCCCCACCCGG + Intergenic
1172269951 20:33649290-33649312 GCACAGCCCCCACCGCAATCTGG - Exonic
1173783297 20:45774247-45774269 ACACACCCACTACCCAATCCAGG + Exonic
1175902934 20:62367089-62367111 GCACCCGCCCTACTTCAACCTGG - Exonic
1176180575 20:63747562-63747584 GTGCCCCCCCAACCCCAACCGGG - Intronic
1176382621 21:6120821-6120843 GCACACCCCCGCTCCCAGCCAGG + Intronic
1178902119 21:36606288-36606310 ACACACCCCCCACCCCAAAGTGG - Intergenic
1179740848 21:43417418-43417440 GCACACCCCCGCTCCCAGCCAGG - Intronic
1179810068 21:43864888-43864910 GCCCGCCCCCTCCCCCAGCCCGG + Intergenic
1179830625 21:43993926-43993948 AGCCACCCCCTACCCCATCCTGG - Intergenic
1180183075 21:46126612-46126634 GCACGGCCCCTCCCCCAGCCCGG - Intronic
1180255518 21:46624697-46624719 GCACAGCCCTGACCCCATCCTGG + Intergenic
1180338658 22:11600602-11600624 GGCCACCCCCTGCCCCCACCCGG + Intergenic
1180842902 22:18967560-18967582 TCCCACCCCCACCCCCAACCTGG - Intergenic
1180851312 22:19023209-19023231 GCACACCCCCTCCCTCCCCCTGG + Intergenic
1181938020 22:26452804-26452826 TCACACCGCCTACCACCACCTGG + Exonic
1182038742 22:27219849-27219871 GCCCTCCCCCCACCCCACCCAGG + Intergenic
1183117442 22:35702699-35702721 CTCCACCCCCCACCCCAACCAGG - Intergenic
1183284396 22:36953123-36953145 GCAGACCCCCTTCCCAACCCAGG - Intergenic
1184101603 22:42344006-42344028 GAGCCCCCCCTACCCCAGCCCGG - Intergenic
1184259288 22:43305510-43305532 GCACACACCATTCCCCTACCTGG - Intronic
1184550121 22:45200000-45200022 GCACACCCCCCACCCCAGAACGG - Exonic
1185397633 22:50600929-50600951 GCACCCCCCCGACCCCGACCCGG + Intronic
1185418025 22:50720614-50720636 CGACAGCCCCTACGCCAACCTGG + Intergenic
949665554 3:6334781-6334803 GCACACCTCCTTCCCGGACCAGG + Intergenic
950419890 3:12892588-12892610 GCACCCCCCCCACCCCACCCAGG + Intergenic
950475741 3:13213965-13213987 GCCCTCTCCCAACCCCAACCTGG + Intergenic
953027832 3:39154752-39154774 GGTCACCCCCACCCCCAACCTGG - Intergenic
953771228 3:45779922-45779944 CCACACCCCCTTCCCCGAGCGGG + Intronic
954445745 3:50545974-50545996 GCCCATCCCCCACCCCACCCAGG + Intergenic
955956266 3:64293109-64293131 GCCCACCCCCTACCCCACACCGG - Intronic
958750419 3:98188360-98188382 GCACACCCCCTCCCTTAAACGGG - Intronic
960653939 3:119981630-119981652 GCAGACACCCTTCCCCAGCCAGG - Intronic
962431322 3:135323192-135323214 GCACTCCCGCTGCCCCACCCTGG + Intergenic
963827354 3:149970428-149970450 GCGTGCCCCCTCCCCCAACCCGG + Intronic
963840186 3:150096849-150096871 GCACAGCCCTTCCCCCAACTTGG - Intergenic
964701696 3:159574818-159574840 GCAGACGCCCCTCCCCAACCAGG + Intronic
967919331 3:194602729-194602751 ACACACCCCCTCCCCTCACCGGG - Intronic
967962935 3:194940003-194940025 GCCCACCCCCGACCTGAACCAGG + Intergenic
969112405 4:4852115-4852137 CCACAGCCCCCACCCCAACCTGG - Intergenic
970316292 4:14831443-14831465 GCACACCCCCTGCCCATGCCTGG - Intergenic
971196589 4:24475949-24475971 CCCCACCCCCTACCCTCACCGGG + Intergenic
972638024 4:40901435-40901457 GAGCACCCCCCACCCCCACCAGG - Intronic
975132338 4:70842024-70842046 CCACACCCCCTCTCCCAGCCAGG - Intergenic
975203275 4:71616201-71616223 GCAGACCCCCTCCCCCCACCAGG - Intergenic
977584546 4:98760539-98760561 GACCACCCCATCCCCCAACCTGG + Intergenic
978028942 4:103914447-103914469 TCCCTCCCCCTACCCCCACCAGG - Intergenic
978494027 4:109340013-109340035 GCAGACACCCTCCCCCAGCCAGG - Intergenic
981232874 4:142378963-142378985 CCGCACCCCCTACCCCACTCAGG - Intronic
981532121 4:145763060-145763082 ACACAACCCCTACGCCAAGCTGG + Intronic
983254659 4:165384382-165384404 GCACTCCTCCTGCCTCAACCAGG - Intronic
983961197 4:173757109-173757131 TCATACCCCCTACCCATACCTGG + Intergenic
985717178 5:1469256-1469278 GCACATACCCCACCCCAAGCAGG + Intronic
990176033 5:53109693-53109715 GCACACCCGCCACCCTTACCTGG + Exonic
991642207 5:68766302-68766324 ACACACAACCTACCCGAACCGGG + Intergenic
991671666 5:69054403-69054425 GTACAACCCCTTCCCCAACAAGG + Intergenic
993117113 5:83732732-83732754 CCTCACCCCCTACCCCCAACAGG + Intergenic
994494670 5:100496267-100496289 GCACACAGCCTACCCCAAAAGGG - Intergenic
995489825 5:112679221-112679243 GCAGACCCCCTTCCCCAGCCAGG + Intergenic
997473080 5:134127533-134127555 GGAAACCCCCTAGCCCAGCCCGG - Intronic
997647773 5:135492294-135492316 CTATACCCCCTACCCAAACCAGG + Intergenic
998166994 5:139849785-139849807 GCACACTCTCCACCCCATCCTGG + Intronic
998372920 5:141672658-141672680 GCCCACCCCCTGACCCCACCAGG - Exonic
999231949 5:150066854-150066876 TCAGACCCCCAACCCCACCCTGG + Intronic
999318965 5:150601468-150601490 GCACAGCCCCTCACCCACCCTGG - Intronic
999328371 5:150657090-150657112 CCCCACCCCCGACCCCACCCCGG + Intronic
1000023539 5:157339283-157339305 CCACTCCCCCAACCCCCACCCGG - Intronic
1002021862 5:176368694-176368716 CCACAGCCCCCACCCCACCCCGG - Intronic
1002021880 5:176368732-176368754 CCACAGCCCCCACCCCACCCCGG - Intronic
1002711648 5:181198541-181198563 CCACAGCCCCTACACCAATCTGG + Intronic
1004561951 6:16760522-16760544 GCACACCCGCTACCCCCGCGCGG + Intronic
1006105744 6:31715297-31715319 GCCCACCCCCCTCCCCAGCCCGG - Intronic
1006794137 6:36721523-36721545 GCACGACCCGGACCCCAACCAGG + Exonic
1007399382 6:41595095-41595117 CCACACCCCTTCCCCCAGCCAGG - Intronic
1007450217 6:41936464-41936486 GGAAACCTCCAACCCCAACCTGG - Intronic
1007504771 6:42327168-42327190 GCACATCCCCTTCTCCTACCTGG - Intronic
1013528648 6:110998681-110998703 CCACTCACCCGACCCCAACCAGG + Intronic
1017966473 6:159271115-159271137 GCCCAGCCCCAACCCCAGCCTGG - Intronic
1019255379 7:46445-46467 ACACACCCCCAACCCAAAGCAGG - Intergenic
1019499227 7:1356018-1356040 CCACACCCCTTACCCCACCAAGG + Intergenic
1019502157 7:1369719-1369741 GCCCACCTCCGACCCCACCCAGG + Intergenic
1019525314 7:1478009-1478031 GCTCACCCCACACCCCACCCTGG - Intronic
1022113558 7:27245316-27245338 GCACACCCGCCTCCCCAGCCTGG - Intronic
1023859363 7:44208327-44208349 GCCCACCCCTTCCCCCACCCCGG + Intronic
1023871101 7:44263460-44263482 GCACACCCTCAACCCCCTCCCGG - Intronic
1023995670 7:45157748-45157770 GCCCCACCCCAACCCCAACCGGG + Intergenic
1024315267 7:48010186-48010208 GCACAGCCCCTATTCCAACATGG + Intronic
1025245138 7:57311207-57311229 GCTCACACCCTATCCCCACCTGG + Intergenic
1025850283 7:65238911-65238933 GGACACCCCCACCCCCAGCCTGG - Intergenic
1026155989 7:67826255-67826277 GGGCACCCCTGACCCCAACCAGG + Intergenic
1026974793 7:74490648-74490670 GCACACACCCCACCCAAACACGG - Intronic
1027239661 7:76318618-76318640 GCCCCCTCCCTACCCCAACCTGG - Intergenic
1029371549 7:100154074-100154096 GCCCACCTCCCACCCCTACCTGG + Exonic
1029642309 7:101828915-101828937 GCACACCCCTTCCCCCTGCCTGG - Intronic
1031974490 7:128085139-128085161 GCACACCCCTCACCCCACCCAGG + Intronic
1032411365 7:131695374-131695396 CCCCACCCTCAACCCCAACCAGG + Intergenic
1037876451 8:22551291-22551313 GCACACCCTCTCCCCCAGCGCGG + Intronic
1038708140 8:29915336-29915358 CCTCACCCCCTACCCCCAACAGG - Intergenic
1039316603 8:36380252-36380274 GCACACTCCCTTCCCAACCCAGG - Intergenic
1039669313 8:39578874-39578896 GCAGCCCCCCTCCCCCCACCAGG - Intergenic
1039817839 8:41110521-41110543 GCACACGCCCTTCCTCAGCCAGG - Intergenic
1040065388 8:43140621-43140643 GCACACCTCCTACCGCCGCCCGG + Intronic
1041128695 8:54672378-54672400 GCCCATGCCCTACCCCTACCTGG - Intergenic
1043165830 8:76901803-76901825 GGACGCCCCCTCCCCCAGCCAGG + Intergenic
1044773606 8:95663923-95663945 GCACATCCCCCACTCCAACTGGG - Intergenic
1049555078 8:143277628-143277650 GCAGACCCCGGACCCCAGCCTGG + Intergenic
1049615886 8:143575702-143575724 GGCCACCCCCTTCCCCACCCAGG - Exonic
1049683869 8:143931516-143931538 GCACACCCCCTCCCTCACCTGGG + Exonic
1050526253 9:6549346-6549368 GCCCACCCCCGACCCCACCCCGG - Intronic
1051062071 9:13056168-13056190 TCAAACTCCCTACTCCAACCTGG + Intergenic
1051274269 9:15384037-15384059 GCACCCCACCCACCCAAACCTGG + Intergenic
1051493091 9:17689015-17689037 CCACACACACTACCCCAGCCAGG + Intronic
1053277611 9:36795147-36795169 CCACCCCCGCTACCCCAGCCTGG + Intergenic
1053337584 9:37289530-37289552 GCATACCCACTACTCCACCCTGG + Intronic
1053704972 9:40743010-40743032 GGCCACCCCCCACCCCCACCTGG - Intergenic
1054266263 9:62918929-62918951 GCAGTCCCCCACCCCCAACCAGG - Intergenic
1054415049 9:64866617-64866639 GGCCACCCCCCACCCCCACCTGG - Intergenic
1056166596 9:83946965-83946987 GCAAACCCCCTGCCTCAGCCTGG - Intronic
1060208899 9:121698862-121698884 TCACACCCCCCACACCCACCTGG - Intronic
1060763985 9:126280087-126280109 CCGCACCCCCAACCCCAACCTGG - Intergenic
1061859389 9:133460284-133460306 GCAGACCCCCGACCCCCAGCGGG - Intronic
1062057401 9:134475651-134475673 GCACAGCCCCCACCCCATCCTGG - Intergenic
1062393492 9:136343256-136343278 GCCCACCCCCCACCCCAGCAAGG + Intronic
1062424427 9:136499435-136499457 GCACAGCCCCTGCCCCCATCCGG - Intronic
1062632054 9:137467465-137467487 GCACAGCCTCTACACCAGCCAGG + Exonic
1062698235 9:137886182-137886204 GCTCAGCCCCGACCCCACCCTGG - Intronic
1203769182 EBV:40353-40375 GCGCACCCCCCACCCCCGCCGGG - Intergenic
1188624666 X:32268904-32268926 CCACCCCCGCCACCCCAACCAGG + Intronic
1189168258 X:38883387-38883409 TCACACTCCCAACCCCACCCTGG + Intergenic
1189202379 X:39208085-39208107 TGACACCTCTTACCCCAACCTGG + Intergenic
1190916475 X:54814824-54814846 GCACACAGCCTGCCCCAGCCAGG - Intronic
1192561756 X:72131962-72131984 GCACTCCCCCCACCCCACGCAGG + Intergenic
1194980503 X:100435381-100435403 ACACACACCCACCCCCAACCAGG + Intergenic
1194993369 X:100568959-100568981 GCACCCCCCCCCCCCCAACAGGG + Intergenic
1196499671 X:116365009-116365031 CCCCACCCCCTACCCCCAACAGG - Intergenic
1198018069 X:132631922-132631944 GCACCACCCCTACCCCAACATGG + Intronic
1198301010 X:135334266-135334288 GGTCACTCTCTACCCCAACCTGG - Intronic
1199558118 X:149131479-149131501 CCTCAGCCCCAACCCCAACCTGG - Intergenic
1200402721 X:156028982-156029004 GCACCCCCCCGCCCCCAGCCCGG + Intergenic