ID: 907049773

View in Genome Browser
Species Human (GRCh38)
Location 1:51322118-51322140
Sequence GACTCCCTTTACCCTTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 115}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907049773_907049786 23 Left 907049773 1:51322118-51322140 CCTCCACAAGGGTAAAGGGAGTC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 907049786 1:51322164-51322186 GGCTCTGCTGCCCCCCCAGGGGG 0: 1
1: 0
2: 3
3: 39
4: 443
907049773_907049777 1 Left 907049773 1:51322118-51322140 CCTCCACAAGGGTAAAGGGAGTC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 907049777 1:51322142-51322164 TTGTGGCCCTTCTGGCCCATTGG 0: 1
1: 0
2: 2
3: 6
4: 117
907049773_907049784 21 Left 907049773 1:51322118-51322140 CCTCCACAAGGGTAAAGGGAGTC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 907049784 1:51322162-51322184 TGGGCTCTGCTGCCCCCCCAGGG 0: 1
1: 0
2: 4
3: 46
4: 442
907049773_907049785 22 Left 907049773 1:51322118-51322140 CCTCCACAAGGGTAAAGGGAGTC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 907049785 1:51322163-51322185 GGGCTCTGCTGCCCCCCCAGGGG 0: 1
1: 0
2: 0
3: 48
4: 377
907049773_907049783 20 Left 907049773 1:51322118-51322140 CCTCCACAAGGGTAAAGGGAGTC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 907049783 1:51322161-51322183 TTGGGCTCTGCTGCCCCCCCAGG 0: 1
1: 0
2: 1
3: 30
4: 348
907049773_907049778 2 Left 907049773 1:51322118-51322140 CCTCCACAAGGGTAAAGGGAGTC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 907049778 1:51322143-51322165 TGTGGCCCTTCTGGCCCATTGGG 0: 1
1: 0
2: 2
3: 16
4: 132
907049773_907049776 -7 Left 907049773 1:51322118-51322140 CCTCCACAAGGGTAAAGGGAGTC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 907049776 1:51322134-51322156 GGGAGTCTTTGTGGCCCTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907049773 Original CRISPR GACTCCCTTTACCCTTGTGG AGG (reversed) Intronic
902682241 1:18051552-18051574 GACAATGTTTACCCTTGTGGGGG - Intergenic
904512861 1:31028401-31028423 GACTCCCTTTGCCATTGGCGGGG + Intronic
905419506 1:37830585-37830607 GATTACCTTTTCTCTTGTGGAGG + Intronic
906075238 1:43047176-43047198 GGCTCCCTTTGCCCAGGTGGAGG + Intergenic
907049773 1:51322118-51322140 GACTCCCTTTACCCTTGTGGAGG - Intronic
908372331 1:63495649-63495671 CACTCTCTCTTCCCTTGTGGAGG + Intronic
910961295 1:92766593-92766615 GACACTATTTACCCTTTTGGAGG - Intronic
919035154 1:192297454-192297476 CACTCCCTTTACCCTAGTATAGG + Intergenic
920951898 1:210580210-210580232 GACTCCTCTTAGCCTTATGGAGG + Intronic
921125826 1:212177160-212177182 CAGTCCCTTTAACCTGGTGGAGG + Intergenic
922556041 1:226532815-226532837 GACTGCCTATGCTCTTGTGGTGG - Intergenic
1067150763 10:43731132-43731154 GACTCCCTTTAGCATTGTGGGGG - Intergenic
1069245132 10:66194872-66194894 GATTCTCTTCACCTTTGTGGTGG - Intronic
1069938570 10:71937313-71937335 GACTCCCTTCAGTCTTGAGGTGG - Intergenic
1070025327 10:72626337-72626359 GATTCCTATGACCCTTGTGGAGG - Intergenic
1070161431 10:73868871-73868893 GACAGCCTTTACCCTTCTGGTGG + Intronic
1072785887 10:98282059-98282081 GCCTCCCTTGACCCATGAGGGGG + Intergenic
1076537682 10:131192391-131192413 GACTCCTTTTACACTGCTGGTGG + Intronic
1080759115 11:35230621-35230643 GAATCCCTTTAACCTTTTGAGGG - Intronic
1082081491 11:48015761-48015783 GAATCCCTTGAACCTGGTGGAGG + Intronic
1088627676 11:111742979-111743001 GACTCCCTTGAACCTTGGGCAGG - Intronic
1099721036 12:86361866-86361888 GAATTCCTTTACCCTGTTGGTGG + Intronic
1102462380 12:113107921-113107943 GACTGCCTTCACCCTTGGGATGG + Intronic
1107727653 13:43316109-43316131 GAGTCCCTTGAGCCTGGTGGAGG - Intronic
1113393275 13:109918433-109918455 GCCTCCCTGTTCCCTGGTGGCGG + Intergenic
1113500488 13:110770268-110770290 TACTCTCTTAACCCTTGTGTGGG - Intergenic
1114682132 14:24493953-24493975 GTCTCCCATTATTCTTGTGGGGG - Intergenic
1114685644 14:24528460-24528482 GTCTCCCATTATTCTTGTGGGGG - Intergenic
1115064840 14:29245196-29245218 GAATCACTTTGCCCTTATGGAGG - Intergenic
1118391733 14:65301512-65301534 GACTGCCTATACCCCTGTGACGG + Intergenic
1120876382 14:89379746-89379768 GAATCCCTTGAACCTGGTGGTGG - Intronic
1123013767 14:105363534-105363556 GACTCCCTTCACCTCTGTGAAGG - Intronic
1124890357 15:33726496-33726518 CACTCCCCTTACCTTTGTTGAGG - Exonic
1125113585 15:36062759-36062781 GATTCCCTTGACCCTTGGGTGGG + Intergenic
1129208795 15:74053485-74053507 GATTCCCTTTGACGTTGTGGGGG + Intergenic
1132436040 15:101803436-101803458 AGCTCCCTTTCCCCCTGTGGAGG + Intergenic
1133248786 16:4466515-4466537 GACCCCACTTACCCTTGAGGAGG + Intronic
1140486155 16:75295252-75295274 GACTACCCTGACCCTTCTGGAGG + Intronic
1140651587 16:77094288-77094310 GATTTCCTTTACCCTTTTGATGG + Intergenic
1146844343 17:36173843-36173865 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1146856648 17:36261778-36261800 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1146863969 17:36326597-36326619 GGCTCCCTTGACCCTGGCGGGGG + Intronic
1146872558 17:36385689-36385711 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1146879916 17:36436774-36436796 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1147066829 17:37927185-37927207 GGCTCCCTTGACCCTGGCGGGGG + Intronic
1147075442 17:37986313-37986335 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1147078361 17:38006746-38006768 GGCTCCCTTGACCCTGGCGGGGG + Intronic
1147086967 17:38065859-38065881 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1147094299 17:38130681-38130703 GGCTCCCTTGACCCTGGCGGGGG + Intergenic
1147102912 17:38189822-38189844 GGCTCCCTTGACCCTGGCGGGGG - Intergenic
1152397317 17:80041680-80041702 GACAACCTTGACCCTTGTGAAGG + Intronic
1156110960 18:33726805-33726827 GACTGCCTTCTCCCTTGAGGGGG - Intronic
1158515352 18:58126053-58126075 GACTCCCTTTAGCCTTGAAGGGG + Intronic
1161897203 19:7091301-7091323 GATTCCCTTTACCCTTGACTAGG - Intergenic
925045866 2:772636-772658 GACTTCATTAACCCGTGTGGGGG + Intergenic
929540413 2:42815074-42815096 CCCTCCCTTTACCCATATGGAGG - Intergenic
930666393 2:54103039-54103061 GCCTTCCCTTACCCTTGTGCAGG - Intronic
931228201 2:60352009-60352031 GGCTCCCTTCCCCCTTCTGGAGG + Intergenic
933094867 2:78165539-78165561 GAATGCTTTTACGCTTGTGGTGG + Intergenic
933918291 2:87018785-87018807 AACACCCTGTAGCCTTGTGGTGG - Intronic
934004705 2:87751128-87751150 AACACCCTGTAGCCTTGTGGTGG + Intronic
934939903 2:98493161-98493183 GACTCCCTTTGCCCCTATGCTGG + Intronic
935767662 2:106385161-106385183 AACACCCTGTAGCCTTGTGGTGG + Intergenic
938042896 2:128090877-128090899 TACTCCCTTTAGCCTTTCGGTGG - Intergenic
938558563 2:132449332-132449354 GAATCCCTTGAACCTTGAGGCGG - Intronic
939091887 2:137789611-137789633 CACTCCCTTTACCCTAGTCCTGG + Intergenic
939491044 2:142876795-142876817 AATTCACTTAACCCTTGTGGAGG - Intergenic
943200601 2:184818659-184818681 GTCTGCCTTTACACTTGAGGTGG - Intronic
944892410 2:204131065-204131087 GACTCCCTTTCCCCTCGGGTTGG + Intergenic
945466085 2:210171554-210171576 GACTCCCTTAACTCTGGTGCAGG + Intergenic
948293671 2:236845635-236845657 GCCTCCCTGTGCTCTTGTGGGGG - Intergenic
1168917181 20:1499882-1499904 TACTCCCTATAGGCTTGTGGTGG - Intergenic
1171009886 20:21503452-21503474 CACTCCCTTTTCCCTTGTGCTGG - Intergenic
1171398694 20:24857706-24857728 GCCTCCCTCGCCCCTTGTGGTGG - Intergenic
1172513412 20:35515894-35515916 TACTCCCTCTACCCTGCTGGAGG + Exonic
1172940604 20:38651302-38651324 GGCTCCCTTGACCCTTGGGTAGG - Intergenic
1175070178 20:56326345-56326367 GACTCCCATTGCCCTTGTTCTGG - Intergenic
1183433817 22:37781944-37781966 GACTCCCTGTTCCCTTGGGATGG + Intergenic
1183528584 22:38339188-38339210 GACTCCCTTTAGCCCAGTGGGGG - Intronic
949655724 3:6216588-6216610 GACTCCCATTACCCATGGAGAGG - Intergenic
950098792 3:10345036-10345058 GCCTCCCTCTGCCCTCGTGGTGG + Intronic
954377989 3:50205056-50205078 GACTCCGTTGAGTCTTGTGGGGG - Intergenic
954970399 3:54646917-54646939 GAGTCTCTCTGCCCTTGTGGAGG - Intronic
955287534 3:57657631-57657653 GACTTCCTTTTGCTTTGTGGTGG - Intronic
959682327 3:109109663-109109685 CACTCACTTTTCCCCTGTGGAGG + Intronic
969835895 4:9841247-9841269 GACACCCATTATCCTTGTGTTGG + Intronic
971137502 4:23885979-23886001 GACTCCCCTTACCAATGAGGTGG + Intronic
982521690 4:156425317-156425339 GAATCCCTTAACCCCTGTGTTGG + Intergenic
988621827 5:32830962-32830984 GACTAGCTTTTGCCTTGTGGTGG + Intergenic
991247762 5:64525954-64525976 GATTCCCTTCTCCCTTATGGTGG - Intronic
992810852 5:80387024-80387046 GACTCCCTTTGCCCCCTTGGTGG + Intergenic
998974750 5:147633051-147633073 TACTCACTTTGCCCTTGTGATGG + Intronic
1001260689 5:170225878-170225900 GACTTCCTTTTCCCTTGTCTAGG + Intergenic
1004271056 6:14195874-14195896 GACTGCCTTTTCCCTGGTGCTGG - Intergenic
1009712805 6:67346898-67346920 GACCCCCTTTTCTCTTGTGGGGG - Intergenic
1009731515 6:67613895-67613917 GACTACTTTTACACTTTTGGTGG - Intergenic
1011992190 6:93535812-93535834 GAATGCCTTTACCCTGTTGGTGG - Intergenic
1018128496 6:160705289-160705311 GACACCCTGTAGCCTTGTGGTGG + Intronic
1022110451 7:27226971-27226993 GTCTCCCTTTACCCTGGAGGTGG - Intergenic
1026508079 7:71003620-71003642 TCCTCCCTTTCCCCTTCTGGTGG + Intergenic
1027335467 7:77146025-77146047 GTCTCCCATTATCATTGTGGGGG + Intronic
1029780325 7:102725072-102725094 GTCTCCCATTATCATTGTGGGGG - Intergenic
1030107911 7:106002133-106002155 GTCACCCTTCACCTTTGTGGGGG + Intronic
1031256213 7:119451695-119451717 GACTCTCTTTACACTGGTGGTGG + Intergenic
1039457575 8:37717672-37717694 GACTCCATCTGCCCTTGTGCAGG - Intergenic
1040312401 8:46243591-46243613 GACCCCGTTTTCTCTTGTGGGGG - Intergenic
1040324468 8:46334730-46334752 GACTTCCTTTTCGCTTGTGGGGG - Intergenic
1040330923 8:46385395-46385417 GCCTCCGTTTACACTTTTGGGGG - Intergenic
1040336190 8:46417247-46417269 GGCCCCGTTTACACTTGTGGAGG - Intergenic
1040337908 8:46425486-46425508 GGCTCCGTTTTCACTTGTGGGGG - Intergenic
1044067869 8:87720810-87720832 GAATGCTTTTACACTTGTGGTGG - Intergenic
1047300715 8:123611680-123611702 GAATGCTTTTACACTTGTGGGGG - Intergenic
1047756493 8:127922902-127922924 GACTCCCGTGACTCTTTTGGGGG - Intergenic
1047822615 8:128538052-128538074 GACTTCCTGTGTCCTTGTGGAGG + Intergenic
1057748192 9:97769253-97769275 GACTCACTTGACCCTGTTGGGGG - Intergenic
1058794311 9:108483364-108483386 GCCTTCCTTGGCCCTTGTGGGGG + Intergenic
1060280335 9:122211671-122211693 CTCTCCTCTTACCCTTGTGGTGG - Intronic
1060679500 9:125549003-125549025 GACTCCCTTTGCGGCTGTGGAGG - Intronic
1062652034 9:137582823-137582845 GTCTCCCTTTGCCCTTGTGCTGG - Intronic
1185933949 X:4234622-4234644 GACTCCCTTTACCCTCTGGAAGG + Intergenic
1186855471 X:13621964-13621986 CACTCGCTTTCCCCATGTGGAGG + Intronic
1187786093 X:22888266-22888288 GACTCCCTGTTTCCTGGTGGAGG + Intergenic
1193263773 X:79442809-79442831 GACACCCTGTACACTTTTGGTGG - Intergenic
1195148293 X:102040722-102040744 GAATGCCTTTACACTTTTGGTGG + Intergenic
1196569837 X:117252899-117252921 GAATGCCTTTACACTTTTGGTGG - Intergenic
1200021410 X:153213389-153213411 GACTCCATTTGCCAGTGTGGTGG + Intergenic
1201424128 Y:13830756-13830778 GACACCCTGAACCTTTGTGGAGG + Intergenic