ID: 907050810

View in Genome Browser
Species Human (GRCh38)
Location 1:51329137-51329159
Sequence ATGTAAGCATATAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907050803_907050810 7 Left 907050803 1:51329107-51329129 CCCGGGGTTGTAGAGGGCACTTA 0: 1
1: 0
2: 0
3: 9
4: 206
Right 907050810 1:51329137-51329159 ATGTAAGCATATAAGGAAGTGGG 0: 1
1: 0
2: 0
3: 27
4: 274
907050804_907050810 6 Left 907050804 1:51329108-51329130 CCGGGGTTGTAGAGGGCACTTAG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 907050810 1:51329137-51329159 ATGTAAGCATATAAGGAAGTGGG 0: 1
1: 0
2: 0
3: 27
4: 274
907050796_907050810 28 Left 907050796 1:51329086-51329108 CCTGCAGCAGGGCCAGAGGTGCC 0: 1
1: 0
2: 5
3: 46
4: 449
Right 907050810 1:51329137-51329159 ATGTAAGCATATAAGGAAGTGGG 0: 1
1: 0
2: 0
3: 27
4: 274
907050800_907050810 16 Left 907050800 1:51329098-51329120 CCAGAGGTGCCCGGGGTTGTAGA 0: 1
1: 0
2: 0
3: 6
4: 65
Right 907050810 1:51329137-51329159 ATGTAAGCATATAAGGAAGTGGG 0: 1
1: 0
2: 0
3: 27
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907050810 Original CRISPR ATGTAAGCATATAAGGAAGT GGG Intronic
901941237 1:12663514-12663536 ATGCAAGGGTATTAGGAAGTGGG - Intronic
904459559 1:30668077-30668099 ATGGAAGGATAGAAGGGAGTAGG + Intergenic
905970016 1:42134707-42134729 ATGGAAGCATGAACGGAAGTGGG - Intergenic
907050810 1:51329137-51329159 ATGTAAGCATATAAGGAAGTGGG + Intronic
907134677 1:52128761-52128783 ATGGAAGCAGATGAGGAAATAGG - Intergenic
907355840 1:53873253-53873275 ATGGGAGCATATAGGGAAGGTGG + Intronic
907620837 1:55977584-55977606 GAGTAGGCATATAAAGAAGTTGG + Intergenic
907783446 1:57588786-57588808 ATTTTAGCATATAATGAAGAAGG + Intronic
909107164 1:71426043-71426065 ATGTATGCATATATGTATGTAGG - Intronic
909197485 1:72646518-72646540 ATGTAATAATATTAGGAGGTGGG + Intergenic
909217439 1:72908374-72908396 ATATAAGCATATAACTATGTAGG + Intergenic
910036846 1:82799054-82799076 TTGTAAGAATATAAAGAGGTGGG - Intergenic
910483029 1:87679215-87679237 ATGTGATCATATTAGGAGGTAGG + Intergenic
912583817 1:110743577-110743599 CTGTACTAATATAAGGAAGTGGG + Intergenic
914403969 1:147351370-147351392 ATGTATGCATGAAAGGAAGAGGG - Intergenic
915029592 1:152866581-152866603 AAGTAACCATAAAAGAAAGTTGG + Intergenic
918191123 1:182175477-182175499 AACTAAGCATACAGGGAAGTGGG - Intergenic
918232173 1:182546217-182546239 ATGTTAGCATAGAAGCAAGTTGG - Intronic
918985584 1:191621358-191621380 ATGTAATACTATTAGGAAGTGGG + Intergenic
920275427 1:204800886-204800908 ATGTAAGGGTATCAGGAGGTGGG - Intergenic
923938191 1:238788839-238788861 ATGTACGCATATATGTATGTAGG + Intergenic
1063878762 10:10509336-10509358 ATGTAACAATATTAGGAAGTGGG + Intergenic
1065340645 10:24701562-24701584 ATGAAAGTATTTCAGGAAGTGGG + Intronic
1065962043 10:30741773-30741795 ACGTGAGCATTTAAGGAATTTGG + Intergenic
1066290237 10:34007832-34007854 ATGGAAGCATATAGGGAGGAAGG - Intergenic
1067357871 10:45548024-45548046 ATGAAAGAACATAAGGATGTGGG - Intronic
1068426335 10:56869653-56869675 ATGTATGCATTTAATGAAGCAGG + Intergenic
1068983343 10:63084430-63084452 AGGAAAGCAAATAAGGAACTAGG - Intergenic
1069502027 10:68962267-68962289 ATGCAGTCATATAATGAAGTAGG + Intronic
1070970422 10:80561633-80561655 ATGTTACCATAAAAGGAAGCTGG - Intronic
1071242838 10:83727425-83727447 ATGGAAGCATATATGACAGTTGG - Intergenic
1071351945 10:84755337-84755359 ATGTGAGAATATGAGGAAATGGG + Intergenic
1073533047 10:104250601-104250623 ATGTCAACATAAAAGGAAGAGGG + Intronic
1076145367 10:128114802-128114824 ATGTAAGCACATAAGGCACAGGG - Intronic
1077829485 11:5849499-5849521 TGATAATCATATAAGGAAGTGGG + Intronic
1078249654 11:9606700-9606722 ATGTAATGAGATAAGGAAGGGGG + Intergenic
1079495391 11:21037540-21037562 ATGTATGCATATAAAAAACTAGG - Intronic
1079934315 11:26598453-26598475 ATGTTAGGATACAAGGAAATAGG + Intronic
1080785302 11:35469927-35469949 CTGTGATCATATTAGGAAGTAGG - Intronic
1081256227 11:40898933-40898955 ATGTATGTATCTAAGGAAATAGG - Intronic
1082115034 11:48318961-48318983 AAGTAAACATGTAAGAAAGTTGG - Intergenic
1082258630 11:50060339-50060361 AAGTAAACATGTAAGAAAGTTGG + Intergenic
1086192371 11:84094745-84094767 ATGTAATGATATCAGGAGGTGGG - Intronic
1086272541 11:85084348-85084370 ATCTAAGAAAATATGGAAGTAGG + Intronic
1086972036 11:93092080-93092102 ATTTAAGCATCTAATGAAATAGG + Intergenic
1086972435 11:93098111-93098133 ATGTAAGGATATTGGGACGTGGG + Intergenic
1087816742 11:102666195-102666217 ATGTAAACACATAAAGGAGTGGG + Intergenic
1088934639 11:114387355-114387377 ATGTGATAATATTAGGAAGTAGG + Intergenic
1090222421 11:125040000-125040022 ATGTCATCATAGAATGAAGTTGG - Intronic
1090849326 11:130558207-130558229 ATGTAACCATATTGAGAAGTGGG + Intergenic
1092529467 12:9332495-9332517 ATGTAATGATATTAGGAGGTGGG + Intergenic
1093698794 12:22194508-22194530 AAGGAAACACATAAGGAAGTAGG + Exonic
1095276118 12:40284503-40284525 ATGTAAGCATATAAAAAGTTAGG - Intronic
1095624495 12:44298923-44298945 ATGTAAGAAGATAAGGCAGATGG - Intronic
1097437473 12:59569214-59569236 ATGTATGCATATATAGAAGAGGG - Intergenic
1097712252 12:62929873-62929895 ATGTAAGGATAAAAAGGAGTGGG - Intronic
1097886000 12:64730044-64730066 ATGTAAGCATAGAAGTCACTTGG + Intronic
1098472617 12:70862966-70862988 AAGAAAGCATAAAAGGAAGAAGG + Intronic
1100126243 12:91429870-91429892 ATATTAACATATAAGGAAGAAGG + Intergenic
1100233973 12:92638780-92638802 ATGTAATGGTATTAGGAAGTAGG - Intergenic
1101506270 12:105349507-105349529 GTGTAAGCCAATAAGAAAGTGGG - Intronic
1103567999 12:121826757-121826779 GTGGAAGAATATGAGGAAGTGGG + Intronic
1105329071 13:19398065-19398087 ATTTAAGCATTAAAGGAAATGGG + Intergenic
1105426408 13:20298468-20298490 AGGGAAGCATCCAAGGAAGTGGG + Intergenic
1107421871 13:40254808-40254830 AGGCAGGCATTTAAGGAAGTTGG + Intergenic
1107700814 13:43045807-43045829 AATTAAGCAGATAAAGAAGTAGG - Intronic
1109430524 13:62227719-62227741 ATCTAAGTATATAGGTAAGTTGG + Intergenic
1111966696 13:94868735-94868757 ATGTAAGTGTATTTGGAAGTGGG + Intergenic
1112606201 13:100909330-100909352 ATGTAAGAATTTCAGGAAGGAGG - Intergenic
1112608113 13:100927952-100927974 ATGCAATCATATTAGGAGGTGGG - Intergenic
1112809615 13:103202747-103202769 ATGGAAGTTTATAAGGAAATAGG + Intergenic
1113098543 13:106692141-106692163 ATGTAGGCATATAAGGAAAAGGG - Intergenic
1113329309 13:109313024-109313046 ATTTAAGCATATAAAGAACTTGG - Intergenic
1115941033 14:38609908-38609930 TTGTAATAATATTAGGAAGTGGG - Intergenic
1118461715 14:65993376-65993398 ATGTAGGCATATGGGGAAGAGGG + Intronic
1120415571 14:84214932-84214954 ATGTAATGATATTAGGAGGTGGG + Intergenic
1123996547 15:25721878-25721900 ATGGAAACGTATAAGGAAATTGG + Exonic
1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG + Intronic
1125211691 15:37223781-37223803 ATGTAAGGATATAAGTAGATGGG - Intergenic
1125408809 15:39383429-39383451 ATGTGAGGATATTAGGAAGTGGG - Intergenic
1125655756 15:41355472-41355494 ATATAAACATATTAGAAAGTTGG - Intronic
1125908974 15:43419318-43419340 ATGTTATCATATAAGGACCTGGG - Intronic
1126358196 15:47818288-47818310 TTGCAAGCATGAAAGGAAGTCGG + Intergenic
1126540548 15:49817676-49817698 ATGTAAGCACATAGAGATGTAGG - Intergenic
1126956039 15:53934911-53934933 ATGTAATGATATTAGGATGTGGG - Intergenic
1128469835 15:67943001-67943023 ATGTGATGATATTAGGAAGTGGG + Intergenic
1128796812 15:70472337-70472359 ATGCAATCATATTAGGAGGTGGG - Intergenic
1130646060 15:85728277-85728299 ATGTAAGCACCTAAGGAGTTTGG + Intronic
1131561664 15:93448897-93448919 ATTTATGCATATAAGCAATTTGG + Intergenic
1132095355 15:98980460-98980482 AAGTAAACAAATAAGTAAGTGGG + Intronic
1132225790 15:100140303-100140325 ATGTTAACATAACAGGAAGTTGG + Intronic
1135169428 16:20170144-20170166 ATGTAAGCTTATTTGGAAATAGG - Intergenic
1135974318 16:27097402-27097424 ATGTAACCATATTAAGAAGTGGG - Intergenic
1138942644 16:61808854-61808876 TTGTAAGCATAAAAGGATGACGG + Intronic
1139047235 16:63076534-63076556 ATGGAAGCATAGAAGCAAGTTGG - Intergenic
1140258985 16:73361003-73361025 ATAAAAGCAAATAAGGAAATGGG + Intergenic
1143286853 17:5796542-5796564 AGGTGAGAATGTAAGGAAGTTGG - Intronic
1143928543 17:10395936-10395958 ATGTAAAAATATATAGAAGTAGG - Intronic
1145745783 17:27318650-27318672 ATGTAATGATATTAGGGAGTGGG + Intergenic
1149136908 17:53377803-53377825 TTGTCATCATATAAGGATGTTGG + Intergenic
1151131707 17:71903954-71903976 ACACAAGCATATGAGGAAGTCGG + Intergenic
1151687095 17:75654043-75654065 TTGTAAACATATTGGGAAGTTGG - Intronic
1153161187 18:2206407-2206429 ATGTGATGATATAAGGAGGTGGG - Intergenic
1153912168 18:9713961-9713983 ATGTGAGGATATTAGGAGGTGGG - Intronic
1155911960 18:31514216-31514238 ATGTTAACATATGAGGAAATTGG + Intronic
1157689029 18:49665687-49665709 AGGTAAGGGTATCAGGAAGTGGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159506619 18:69346202-69346224 AAGTAAGCATTTTATGAAGTGGG - Intergenic
1159681701 18:71361636-71361658 ATATAAGCATATAAGCATCTAGG + Intergenic
1160400710 18:78609232-78609254 ATAAAATCATATAAGGAAATGGG + Intergenic
1162849712 19:13421548-13421570 ATGTGAAGATATTAGGAAGTGGG + Intronic
1163393460 19:17044819-17044841 ATTTAACCATTTAAGGAAATTGG + Intergenic
1163393583 19:17045611-17045633 ATTTAACCATTTAAGGAAATTGG - Intergenic
1164351812 19:27356101-27356123 ATGGAAGCATATCATGAAATAGG - Intergenic
1166576609 19:43846471-43846493 ATGTAAACATATAAACAAATGGG - Intronic
1167527269 19:49992508-49992530 TGATAAGGATATAAGGAAGTAGG - Intronic
1168531442 19:57132812-57132834 ATATAAGTTTATAAGGAATTTGG + Intergenic
925024296 2:595523-595545 ATGACAGCACATAAGAAAGTCGG + Intergenic
925311983 2:2891132-2891154 ATGTAAGCACATCTGGAGGTAGG + Intergenic
925916923 2:8613589-8613611 ATGGAAGCATGGATGGAAGTAGG + Intergenic
926449210 2:12981872-12981894 ATGTGAGGATATTAGGAAGTGGG - Intergenic
927599905 2:24431686-24431708 TTGCAAGCATATAGGGAAGAAGG + Intergenic
929815997 2:45232087-45232109 ATGTGATCATATTAGGAGGTGGG - Intergenic
930820479 2:55641562-55641584 AGGTAAGGATTTAAGGAAGGTGG + Intronic
931121429 2:59224735-59224757 ATGTTGGCATTTAAGGCAGTGGG + Intergenic
932461109 2:71882631-71882653 ATGTGAGCCTAAAAGGAAGATGG + Intergenic
933373985 2:81455322-81455344 ATGTAAGTATTTCAGGCAGTAGG + Intergenic
935386743 2:102507540-102507562 ATGCAAGCAAAGAAGGAAGTTGG - Intronic
935424488 2:102905890-102905912 GTGTAAGCATATAAGATGGTGGG + Intergenic
936387801 2:112045321-112045343 ATGTAAGCAAAGAAGACAGTAGG - Intergenic
937085095 2:119166394-119166416 ATGAAGGCAGAGAAGGAAGTTGG - Intergenic
937567490 2:123312474-123312496 ATGTAATGATATTAGGAGGTGGG - Intergenic
939080479 2:137654784-137654806 ATGTCAGCATAGAAGCAAGCTGG - Intronic
939301121 2:140340529-140340551 AAATAAGGAAATAAGGAAGTAGG + Intronic
940776494 2:157889954-157889976 ATGTAAACAAATATGGAAGAAGG - Intronic
941929713 2:170927905-170927927 ATGTATGCATATGAAGATGTGGG - Intergenic
943042855 2:182823898-182823920 ATGTAGCCATATTAGGGAGTTGG - Intergenic
943143588 2:184014628-184014650 AAATAAGCAAATAAGGAAGGAGG - Intergenic
943232663 2:185275259-185275281 ATATAAACGAATAAGGAAGTGGG - Intergenic
944666303 2:201962274-201962296 TTGTATGCATATAAGCAAGAGGG + Intergenic
947189410 2:227486460-227486482 ATGTAAGTTAATAAGGCAGTAGG - Intronic
947264722 2:228266121-228266143 AGGTAAGAATGTAACGAAGTGGG - Intergenic
948124620 2:235555645-235555667 TTGGCAGAATATAAGGAAGTTGG + Intronic
1169304891 20:4481117-4481139 TTGTAAGCAAATAAGGAATCTGG - Intergenic
1169839549 20:9919989-9920011 ATGTAACCATATTTGGAAATAGG - Intergenic
1170833205 20:19861240-19861262 ATGGAAACCTATAAGGAGGTGGG - Intergenic
1171015150 20:21534047-21534069 ATGTAACGGTATAAGGAAGTGGG + Intergenic
1171318444 20:24217106-24217128 AAATAAGCATATTAGAAAGTGGG + Intergenic
1172371066 20:34392442-34392464 ATGTAAGCACAGAATGAAGTAGG + Intronic
1172543362 20:35739644-35739666 ATGTAAACAGGTATGGAAGTAGG - Intronic
1172688627 20:36775348-36775370 AGGCAAGCATAAAAGGAACTGGG - Intergenic
1173824093 20:46036333-46036355 ATGTAAATATATCAAGAAGTAGG - Intronic
1174366412 20:50059233-50059255 ATGTGACCATATTTGGAAGTAGG + Intergenic
1175362988 20:58429396-58429418 ATGCAAGCACACAAGGCAGTGGG - Intronic
1176914233 21:14605618-14605640 ATGTAAGCATATAAATATTTTGG - Intronic
1178447265 21:32657659-32657681 ATGTAAACTTATGAGGAAGCAGG - Intronic
1181338930 22:22163250-22163272 ATGTCAGGATAGAAAGAAGTTGG + Intergenic
1181677063 22:24462168-24462190 CTGTCAGAATATAAGTAAGTTGG + Intergenic
1185005096 22:48271168-48271190 ATGTAATGATATTAGGAGGTGGG - Intergenic
1185120100 22:48960897-48960919 CTGTAACCACTTAAGGAAGTGGG - Intergenic
949407246 3:3727375-3727397 ATGTCAGAAGAGAAGGAAGTAGG + Intronic
949639771 3:6022802-6022824 ATGTAATCATGTGAGGCAGTTGG - Intergenic
950311666 3:11963880-11963902 ATGTAAGCATGCATGGTAGTGGG - Intergenic
950766052 3:15273884-15273906 ATGTGATTATATTAGGAAGTGGG + Intronic
952138089 3:30446252-30446274 ATGTAAGCATATACTGGAGAGGG + Intergenic
952185872 3:30968289-30968311 ATGTAACCATATTAGGAAGATGG + Intergenic
955473726 3:59313741-59313763 AAGTAAGATTAGAAGGAAGTAGG - Intergenic
955660555 3:61294483-61294505 ATGTAAGTTTAGAAGGAAATTGG - Intergenic
956756985 3:72398370-72398392 AAATAAGTATAAAAGGAAGTTGG - Intronic
957543179 3:81602637-81602659 AGGTGATCATATTAGGAAGTGGG - Intronic
958086293 3:88812299-88812321 ATGTAGGTATTTAAGGAAATAGG + Intergenic
958580774 3:96018920-96018942 ATGTAAGAATATTAGGAGGTGGG + Intergenic
958827773 3:99052649-99052671 ATGTATGCATGTAATGAAGAAGG - Intergenic
959795576 3:110424151-110424173 ATGTAACCATATATGGAAATAGG + Intergenic
960335114 3:116407989-116408011 ATGTAAGCTTATTAAGGAGTAGG + Intronic
960457547 3:117891575-117891597 ATGTAATGATATTAGGAAGTGGG - Intergenic
960463157 3:117961736-117961758 ATATAATCATATAAGAAAGGTGG - Intergenic
962597536 3:136961767-136961789 ATGTTAGCATTCAGGGAAGTTGG + Intronic
964829467 3:160867544-160867566 ATTTAAGCATATAAGGAAAAAGG - Intronic
967290312 3:187913380-187913402 ATGGAGGCTTATAAGCAAGTGGG + Intergenic
971582255 4:28356887-28356909 ATGAAAGCCTGGAAGGAAGTAGG - Intergenic
973089735 4:46120324-46120346 ATGTAAGAATATAAGGATGAAGG - Intronic
973538589 4:51910249-51910271 ATGGAAGCATATAAGAAAGACGG + Intronic
973604410 4:52572156-52572178 ATGTAATGTTATTAGGAAGTGGG - Intergenic
973619054 4:52709655-52709677 ATGGAAGAAGATGAGGAAGTAGG + Intergenic
974325454 4:60408624-60408646 ATGAAAGCATTTGAGGAAGGAGG - Intergenic
974555401 4:63440351-63440373 ATGTGAGCATATAAGGTAACAGG - Intergenic
974841416 4:67303627-67303649 AGGTAAGAATATAAGCAAATTGG - Intergenic
976294547 4:83456362-83456384 ATTTAAACGTATGAGGAAGTTGG + Intronic
976528044 4:86116155-86116177 ATGAAGGCATATAAGGGAGTTGG + Intronic
977112287 4:92973316-92973338 ATGAAATTATATAAGGAAGCAGG + Intronic
977536094 4:98258815-98258837 ATGTAATTAGATAAGGAAGTAGG + Intergenic
977546614 4:98389527-98389549 ATGTGAGTATATAATGAATTTGG + Intronic
978328633 4:107587301-107587323 ATGTAAGTATTCAAGGAAGGAGG - Intergenic
980843058 4:138290076-138290098 ATGTGATTATATAATGAAGTTGG + Intergenic
981256587 4:142668301-142668323 TTGTTTGCATAAAAGGAAGTTGG - Intronic
984152944 4:176157040-176157062 ATGTAACCATATATGGAAATAGG - Intronic
984237489 4:177178005-177178027 CTGAAGGAATATAAGGAAGTTGG - Intergenic
984417938 4:179484343-179484365 ATGTAATCATTTAAGGGAGATGG + Intergenic
986745224 5:10737812-10737834 ATGTGAGCTTATTTGGAAGTGGG + Intronic
987024854 5:13915520-13915542 ATTTTAACGTATAAGGAAGTTGG + Intronic
989276036 5:39589921-39589943 AAATAAGCATAAAGGGAAGTGGG + Intergenic
989435188 5:41404448-41404470 ATGCAAGCACATAAGGAAGAAGG + Intronic
991409560 5:66332683-66332705 ATGTAAGAATCTCAGGCAGTAGG + Intergenic
993325191 5:86525774-86525796 ATGTGATCATATGAGGAAATGGG - Intergenic
993418428 5:87666765-87666787 ACATAAACATAAAAGGAAGTGGG + Intergenic
995304175 5:110624169-110624191 ATCTAAGGATATAAGTATGTTGG - Intronic
997514244 5:134475167-134475189 ATATAAGCATAGAAAAAAGTGGG - Intergenic
998521661 5:142806602-142806624 ATGTAAGAAAATACGGAAGAAGG - Intronic
998784827 5:145697934-145697956 ATGTAAGCTTTGAAGTAAGTAGG - Intronic
999170319 5:149588706-149588728 ATTTAAACATTTAAGGAAGGGGG - Intronic
999579514 5:153020597-153020619 ATGAAAGCATATATGCAAGCTGG + Intergenic
1000297754 5:159926914-159926936 AAGTAAACAAATAAGGAAATGGG + Intronic
1002870739 6:1165304-1165326 TTGTAAGCATTTAAAGAGGTGGG + Intergenic
1003516960 6:6825696-6825718 ATGTCAGCACCGAAGGAAGTGGG + Intergenic
1004295422 6:14405671-14405693 ATGTCAGCAAATAAGGGAGGAGG - Intergenic
1004601218 6:17151732-17151754 ATGTAACATTACAAGGAAGTTGG + Intergenic
1005436668 6:25819514-25819536 ATGTACTCATAGAAGTAAGTCGG + Exonic
1005767114 6:29022702-29022724 ATGGCTGCATATAAGGAAGCTGG - Intergenic
1007357326 6:41331321-41331343 ATCTAAGCACAGAAGGAAGAAGG + Intergenic
1008419913 6:51286016-51286038 AAGTAAACATAAAAGGAATTGGG + Intergenic
1008523795 6:52387656-52387678 ATGTAAGGATATTAGGGGGTGGG + Intronic
1008594624 6:53028858-53028880 ATGTAGGCATATATGCATGTGGG + Intronic
1009562707 6:65269864-65269886 ATGTAAGGATATTTGGAGGTAGG - Intronic
1010980885 6:82367166-82367188 TTGTAAGAACATAATGAAGTTGG + Exonic
1012200820 6:96404104-96404126 ATGTAACCATACAAGTAAGGAGG - Intergenic
1012964521 6:105658598-105658620 ATCTAAGAATATTGGGAAGTGGG + Intergenic
1013402497 6:109812499-109812521 ATGTAAGCAAAGAGGGAAATAGG + Intronic
1013412359 6:109893317-109893339 ATGTATTAATATAAGGAAATTGG + Intergenic
1014835896 6:126160161-126160183 GTGTAACCTTATAAGGAAATAGG - Intergenic
1015062969 6:128989965-128989987 ATGTGAGGATATCAGGAGGTGGG - Intronic
1015734222 6:136380585-136380607 AAGAAAGAATATTAGGAAGTTGG - Intronic
1016158667 6:140847404-140847426 TTGTAAGAAAAAAAGGAAGTTGG + Intergenic
1016406057 6:143732012-143732034 ATGGAAGGAGATAAGGCAGTTGG - Intronic
1019098850 6:169610801-169610823 AAGTAAGAATATAAGGTATTAGG - Intronic
1021595934 7:22316915-22316937 ATACAAGCTGATAAGGAAGTAGG + Intronic
1022645242 7:32223612-32223634 ATGTAAGCACATGAGTAAATAGG - Intronic
1022782154 7:33596837-33596859 ATGGAAGAATAGAAGGAAGGGGG - Intronic
1023545163 7:41310992-41311014 ATGTGAGCAGATAACGAATTGGG + Intergenic
1024412477 7:49061044-49061066 ATGGCAGCATAGAAGCAAGTTGG - Intergenic
1027489972 7:78811640-78811662 ATGCAAACACAAAAGGAAGTGGG + Intronic
1028174459 7:87637556-87637578 ATTTAAACATATAAAGAAATAGG - Intronic
1029859916 7:103559539-103559561 ATGCAAGTGTATAAGGAAGAGGG - Intronic
1030357640 7:108560099-108560121 ATGTAATCTTATAAGAGAGTAGG - Intronic
1031295229 7:119993635-119993657 AAATAAGCAAATAAGGAAATGGG - Intergenic
1031600430 7:123701213-123701235 ATGTAAACATATAATGAAGGCGG + Intronic
1031798885 7:126216162-126216184 GTGCATGCATGTAAGGAAGTGGG - Intergenic
1032736908 7:134700985-134701007 ATGTAAGTTTATAAATAAGTGGG - Intergenic
1032995421 7:137440698-137440720 ATGAAAGGACATAAGGCAGTTGG + Intronic
1033938562 7:146621142-146621164 ATGTTAGCATATAACAAAATGGG - Intronic
1035319353 7:158018658-158018680 CTTTAAGAATATAAGAAAGTAGG + Intronic
1036067369 8:5397044-5397066 ATGTGATGATATTAGGAAGTAGG + Intergenic
1036591217 8:10170255-10170277 ATGTGATGATATCAGGAAGTGGG + Intronic
1037413520 8:18622476-18622498 ATGTAAGTATATTGGGAAGATGG - Intronic
1039280450 8:35978524-35978546 AGGTAAGTAGATGAGGAAGTGGG + Intergenic
1039594115 8:38775647-38775669 ATGTGAGAATATTAAGAAGTGGG - Intronic
1040738774 8:50546336-50546358 ATTTAAGCATATCATGATGTTGG + Intronic
1042615564 8:70645023-70645045 ATGTAAACATATAATGATGTAGG - Intronic
1043026489 8:75076704-75076726 ATATATTCATATAAGGAATTGGG - Intergenic
1043520954 8:81044739-81044761 ATGTGAGCAGATAAGACAGTAGG - Intronic
1044249548 8:89989827-89989849 AAGTGAACATACAAGGAAGTGGG - Intronic
1044669217 8:94661889-94661911 ATGTCACCATATCATGAAGTCGG + Intronic
1044876261 8:96669761-96669783 ATGTAAACATATAGGCAATTTGG + Intronic
1045142015 8:99296652-99296674 ATGTGATAATATTAGGAAGTGGG + Intronic
1045244612 8:100432074-100432096 ATGTGAGCAGATAAGAAAGATGG + Intergenic
1045457922 8:102400040-102400062 ATGTTACCATTGAAGGAAGTTGG + Intronic
1047202174 8:122776324-122776346 ATGTGATCATATTAGGAAGTGGG - Intergenic
1050977038 9:11951674-11951696 ATGTCAGCACATAATGGAGTTGG + Intergenic
1051030631 9:12671416-12671438 ATTGATGCATATAAGAAAGTAGG - Intergenic
1052395515 9:27933541-27933563 ATGTGAAAATATAAGGAATTTGG + Intergenic
1052563876 9:30121472-30121494 ATGTAATCTTAGAAGGAAATGGG + Intergenic
1052634503 9:31084401-31084423 ATTTAAACATGTAAAGAAGTGGG + Intergenic
1052671908 9:31568753-31568775 AGGTCATGATATAAGGAAGTGGG + Intergenic
1052943842 9:34151495-34151517 ATGTCTGCAGATAAGGAGGTGGG - Intergenic
1054742240 9:68818944-68818966 ATGTACACATAAAAGGAAGGAGG - Intronic
1054907426 9:70423075-70423097 ATGTCTGCATACAAGGAAGATGG - Intergenic
1055885234 9:81054979-81055001 ATGCAGGCATCTATGGAAGTTGG - Intergenic
1056775505 9:89509424-89509446 ATCTAAGCAGAAGAGGAAGTTGG - Intergenic
1058050050 9:100396340-100396362 ATTTAAGCATCTAAGGATTTTGG - Intergenic
1058220890 9:102300618-102300640 ATATATGCATATAAATAAGTTGG + Intergenic
1058479738 9:105379467-105379489 ATGTTATCATTGAAGGAAGTTGG + Intronic
1058917509 9:109581825-109581847 ATGTAATGATATTAGGAGGTGGG - Intergenic
1059030728 9:110693083-110693105 AAGAAATCAAATAAGGAAGTTGG + Intronic
1060056564 9:120419007-120419029 ATGTAATGGTATTAGGAAGTGGG + Intronic
1060162408 9:121376879-121376901 ATGTAAGCATATACCTAATTGGG + Intergenic
1186184738 X:7009583-7009605 ATGTAAGCATAGAATGCACTGGG + Intergenic
1186490213 X:9966161-9966183 ATGAAAGCAAGCAAGGAAGTGGG + Intergenic
1186711503 X:12202661-12202683 ATGTAACCTTATTAGGAAATAGG + Intronic
1186824607 X:13327020-13327042 ATGGAAGCATACAAGGTTGTAGG + Intergenic
1188623051 X:32250264-32250286 TTGTAAGCAGAAGAGGAAGTGGG - Intronic
1190242429 X:48667920-48667942 ATATAATCATATTAGGAGGTGGG - Intergenic
1190516796 X:51232168-51232190 AACTAAGCATGTAAGCAAGTTGG - Intergenic
1194642705 X:96422067-96422089 ATGAAACGGTATAAGGAAGTGGG - Intergenic
1195774949 X:108392659-108392681 AGGTAAGGATATTAGGAATTAGG + Intronic
1197658262 X:129141692-129141714 ATGGAAGAATATAGGGAAGGGGG + Intergenic
1197912775 X:131502924-131502946 ATTTAAGCAAATAAATAAGTGGG - Intergenic
1198286884 X:135199870-135199892 ATGTAATCATATAGGGAGGTGGG - Intergenic
1198391540 X:136180216-136180238 ATGTGACCATATAACGAAGCGGG - Intronic
1199118476 X:144021313-144021335 ATGTAAACATATTTGGAAATAGG - Intergenic
1199253955 X:145697576-145697598 ATGTGACCTTATTAGGAAGTAGG - Intergenic
1199593749 X:149491029-149491051 ATGTAACCATATTTGGAAATAGG - Intronic
1199877706 X:151947908-151947930 ATGTGAGAATATTTGGAAGTGGG + Intergenic