ID: 907051191

View in Genome Browser
Species Human (GRCh38)
Location 1:51330668-51330690
Sequence GCGGGAGCGCGGGTCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907051191_907051206 20 Left 907051191 1:51330668-51330690 CCCGCGGCGACCCGCGCTCCCGC 0: 1
1: 0
2: 4
3: 27
4: 230
Right 907051206 1:51330711-51330733 GCCCCCACCCCCGCTCCGACAGG 0: 1
1: 0
2: 2
3: 32
4: 346
907051191_907051199 -6 Left 907051191 1:51330668-51330690 CCCGCGGCGACCCGCGCTCCCGC 0: 1
1: 0
2: 4
3: 27
4: 230
Right 907051199 1:51330685-51330707 TCCCGCACCGCCGGGGGTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 65
907051191_907051201 -5 Left 907051191 1:51330668-51330690 CCCGCGGCGACCCGCGCTCCCGC 0: 1
1: 0
2: 4
3: 27
4: 230
Right 907051201 1:51330686-51330708 CCCGCACCGCCGGGGGTTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 75
907051191_907051203 -2 Left 907051191 1:51330668-51330690 CCCGCGGCGACCCGCGCTCCCGC 0: 1
1: 0
2: 4
3: 27
4: 230
Right 907051203 1:51330689-51330711 GCACCGCCGGGGGTTCTGGGCGG 0: 1
1: 0
2: 3
3: 16
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907051191 Original CRISPR GCGGGAGCGCGGGTCGCCGC GGG (reversed) Intronic