ID: 907051191

View in Genome Browser
Species Human (GRCh38)
Location 1:51330668-51330690
Sequence GCGGGAGCGCGGGTCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907051191_907051206 20 Left 907051191 1:51330668-51330690 CCCGCGGCGACCCGCGCTCCCGC 0: 1
1: 0
2: 4
3: 27
4: 230
Right 907051206 1:51330711-51330733 GCCCCCACCCCCGCTCCGACAGG 0: 1
1: 0
2: 2
3: 32
4: 346
907051191_907051201 -5 Left 907051191 1:51330668-51330690 CCCGCGGCGACCCGCGCTCCCGC 0: 1
1: 0
2: 4
3: 27
4: 230
Right 907051201 1:51330686-51330708 CCCGCACCGCCGGGGGTTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 75
907051191_907051203 -2 Left 907051191 1:51330668-51330690 CCCGCGGCGACCCGCGCTCCCGC 0: 1
1: 0
2: 4
3: 27
4: 230
Right 907051203 1:51330689-51330711 GCACCGCCGGGGGTTCTGGGCGG 0: 1
1: 0
2: 3
3: 16
4: 164
907051191_907051199 -6 Left 907051191 1:51330668-51330690 CCCGCGGCGACCCGCGCTCCCGC 0: 1
1: 0
2: 4
3: 27
4: 230
Right 907051199 1:51330685-51330707 TCCCGCACCGCCGGGGGTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907051191 Original CRISPR GCGGGAGCGCGGGTCGCCGC GGG (reversed) Intronic
900096003 1:940362-940384 GCGGGGGCGCTGGGCCCCGCTGG + Intronic
900400381 1:2470644-2470666 GCGGGAGGGAGGGTGGCAGCTGG - Intronic
900786693 1:4654441-4654463 GCGGGGGCCGGGGTCGCCGCGGG - Intergenic
901280037 1:8026600-8026622 GCCGAGGCCCGGGTCGCCGCGGG - Intergenic
901837706 1:11934877-11934899 GCGGGAGCGCGGATCCGGGCGGG + Intronic
902510913 1:16966487-16966509 GCGGGAGCGCCGGGCCACGCTGG + Exonic
903250973 1:22052936-22052958 GCCGGGGCGGGGGTCGCGGCCGG + Intronic
903883723 1:26529642-26529664 GCGGGGGCGGGGGTCCGCGCTGG + Intergenic
904618875 1:31763900-31763922 GCAGGAGCGGGGGCCGGCGCTGG + Exonic
904769030 1:32870803-32870825 GCGCGAGCGCGAGCGGCCGCCGG - Exonic
904775126 1:32901536-32901558 GAGGGAGGGCGGCTCGGCGCCGG - Intergenic
904837728 1:33349819-33349841 GCGGGAGCGCGGGCGGCGGCCGG + Intronic
905124657 1:35708192-35708214 GCGGGAGCGCGGCGCTCAGCTGG - Intergenic
907051191 1:51330668-51330690 GCGGGAGCGCGGGTCGCCGCGGG - Intronic
910760819 1:90729617-90729639 GCAGGGCCGCGGGTCACCGCAGG + Intergenic
911219719 1:95234120-95234142 GCGGAGGCGCGGGGCGCCCCCGG + Intronic
912486681 1:110034737-110034759 GGGGCACCGCGGGCCGCCGCGGG + Exonic
918001641 1:180502591-180502613 GTGCGAGCGCGGGGCGCGGCTGG + Exonic
920886871 1:209938121-209938143 GCGGCCGCGAGGGGCGCCGCGGG - Intergenic
922739416 1:228006995-228007017 GCGGGTGCGCGGGTGTGCGCGGG - Intergenic
922925129 1:229342159-229342181 GCGGGCGCGCGGGGCCCCGGAGG - Exonic
923055899 1:230425933-230425955 GCGGGCGCGCGGGCGGCGGCCGG - Intergenic
924415312 1:243850761-243850783 GAGGGGGCGCGGGGCACCGCTGG - Intronic
924754826 1:246931587-246931609 GCGGGTGAGCGCGCCGCCGCGGG + Intronic
1065588529 10:27242174-27242196 GCAGGAACGCCGGACGCCGCTGG - Intergenic
1066963585 10:42242233-42242255 GCTGGAGCCCGAATCGCCGCCGG - Intergenic
1067110580 10:43397020-43397042 GCGGGAGCTCGGGGACCCGCGGG + Intronic
1070906566 10:80078614-80078636 GAGGGAGCGCGGGCCGGCCCCGG + Intergenic
1072123040 10:92420667-92420689 GCGCGAGCTCGGGGCGCCGAGGG + Intergenic
1072969951 10:100009292-100009314 GCAGGAACGCGGGTGTCCGCGGG + Intronic
1075040581 10:119104260-119104282 GCGGGAGCCCGGGCTGCCCCGGG - Intronic
1075259338 10:120949333-120949355 GTGGGAGCGCAGGGCGCCCCGGG + Intergenic
1075645383 10:124093047-124093069 GAGGGGGCGTGTGTCGCCGCTGG + Intronic
1076450000 10:130550917-130550939 GTGGGAGCAGGGGTCGGCGCAGG - Intergenic
1076916291 10:133424419-133424441 CCGGGAGCGAGGGGCGGCGCGGG - Intronic
1076936398 10:133569214-133569236 CCGGGAGCGAGGGGCGGCGCGGG - Intronic
1077324256 11:1956946-1956968 GCGTGAGCACGGGGCGGCGCCGG + Intronic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1077524797 11:3057548-3057570 TCCGGAGCGCGGGTCGCCATTGG - Intronic
1078934267 11:15938308-15938330 GCAGGAGCGGGGGGAGCCGCGGG - Intergenic
1081831954 11:46121644-46121666 GGGGGAGAGCGGGCCGCGGCGGG + Intergenic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1084979718 11:72822599-72822621 TCGGCAGCCTGGGTCGCCGCAGG - Intronic
1089796566 11:120985975-120985997 GCGGGACTGCGGCGCGCCGCCGG - Exonic
1090190425 11:124762878-124762900 GCGGGAGCCCAGGGCGCCCCGGG + Intergenic
1090211049 11:124921294-124921316 TGGGGAGCGCGGGTAGCGGCGGG + Exonic
1202807242 11_KI270721v1_random:12141-12163 GCGTGAGCACGGGGCGGCGCCGG + Intergenic
1091584411 12:1807835-1807857 GCGGGAGCGGGGGCCCCAGCAGG + Intronic
1094155514 12:27333332-27333354 AGGGGAGCTGGGGTCGCCGCCGG + Intronic
1095440826 12:42237848-42237870 GCCGGAGCGCGGCGCGCCGAGGG - Intronic
1096156072 12:49342272-49342294 GGGGGAGCGGGGTGCGCCGCGGG - Intergenic
1096647590 12:53047185-53047207 GCGCGGGCGCGGGGCGCGGCGGG + Intronic
1096682800 12:53268176-53268198 GCGGGAGCGCGCAGCGCGGCGGG + Intergenic
1096710658 12:53452714-53452736 GGGTGAGCGCGGCTCCCCGCGGG + Intronic
1096848165 12:54419120-54419142 GCAGCAGCGGGGGTCGGCGCCGG + Exonic
1096977522 12:55707951-55707973 GCGGGAGCGAGGGGCGGGGCCGG - Intronic
1097190365 12:57216694-57216716 GGGGGCGCGCGGGGCGCGGCCGG + Intergenic
1098255415 12:68610993-68611015 GGGGGAGCGCGGGGCGACGCTGG + Exonic
1100581251 12:95942701-95942723 GCGGGAGCCCGGGACGCGGAGGG - Exonic
1103698408 12:122835215-122835237 GCGTGTGCCGGGGTCGCCGCGGG + Intronic
1103749778 12:123150858-123150880 GGGGGCGCGCGGGGCGCAGCCGG - Intergenic
1103764656 12:123271630-123271652 GCGGGCGCGCCGGGCGCGGCGGG + Exonic
1103800254 12:123533455-123533477 GGAGGAGCGGGGGTCGGCGCTGG - Exonic
1105000685 12:132687946-132687968 GCGGACGCGGGTGTCGCCGCGGG - Intronic
1105472081 13:20703763-20703785 GGGGGCGCGCGGGCCGGCGCCGG + Intronic
1105745748 13:23375596-23375618 GCGGGTGGGCGTGTCCCCGCGGG - Intronic
1107359445 13:39603087-39603109 CCGGGAGTGGGGGTCTCCGCTGG - Exonic
1107468031 13:40666657-40666679 GCCGGCGCGCGCGCCGCCGCGGG - Intergenic
1112693031 13:101917073-101917095 GCTGGAGGGCGGGTCCCGGCAGG + Intronic
1114483322 14:23048287-23048309 GCGGGAGGGCCGGGCGCCGGGGG + Exonic
1117690463 14:58299562-58299584 GCGGGGGCGCGGTGGGCCGCTGG + Intronic
1117899164 14:60515216-60515238 GCGGGCGCGTGGGTCCCCTCGGG + Intronic
1118797169 14:69153504-69153526 GCCGGCCCGCGGGTCCCCGCGGG - Intergenic
1119823981 14:77641934-77641956 GCGGGAGCCGGGGTCAGCGCGGG + Intergenic
1123023088 14:105411387-105411409 GCAGGCGCCCGGGCCGCCGCTGG + Exonic
1123024896 14:105419934-105419956 GCGGGGGCGGGGGGCGCCGCAGG - Exonic
1123441511 15:20295197-20295219 GCGGGAGACCGAGTCGGCGCCGG + Intergenic
1125524832 15:40368290-40368312 GCGGCAGCGTGGGCAGCCGCAGG - Exonic
1126849847 15:52790257-52790279 GCAGGCGCGCGGGCCGCGGCAGG - Intronic
1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1127982724 15:64046386-64046408 GCGGGAACGGGGGACGCGGCGGG + Intronic
1128223071 15:65982277-65982299 GCCGGCGCGGGGGTCGCAGCTGG + Exonic
1128455633 15:67829871-67829893 CCGCGAGCGCGCGTGGCCGCCGG - Intronic
1129220241 15:74128242-74128264 GCTGGAGCCCGAGTCGCCCCAGG - Exonic
1129503262 15:76059953-76059975 CCGGGAGCGCGAGCCGCGGCCGG + Exonic
1132163700 15:99565509-99565531 GCGGCAGGGCGCGACGCCGCCGG + Intronic
1132697702 16:1209277-1209299 GCGGGAGGGCGGCCGGCCGCAGG - Exonic
1132729218 16:1352327-1352349 GCCGGCGCGGGGGTGGCCGCGGG + Intronic
1132828899 16:1918148-1918170 GCGGGGGCGCGGGCGGCCGGCGG + Exonic
1133121566 16:3611720-3611742 CCGGAAGCGCTGGCCGCCGCGGG - Intronic
1134070033 16:11255311-11255333 GCGGAAGTGCGTGTCGCCGGGGG + Exonic
1134070270 16:11256084-11256106 GGCGGGGCGCGGGACGCCGCGGG + Exonic
1136517357 16:30775947-30775969 GTGGAAGCGCGGGCCGCGGCAGG + Exonic
1136719699 16:32310323-32310345 GCGGGAGCCCGAGTCGCCGCCGG - Intergenic
1136724735 16:32348722-32348744 GTGGGAGCCCCAGTCGCCGCGGG - Intergenic
1136784278 16:32925512-32925534 GCGGGAGCCCGGGCCGGCGGCGG + Intergenic
1136838074 16:33516603-33516625 GCGGGAGCCCGAGTCGCCGCCGG - Intergenic
1136843061 16:33554762-33554784 GTGGGAGCCCCAGTCGCCGCGGG - Intergenic
1136885506 16:33928294-33928316 GCGGGAGCCCGGGCCGGCGGCGG - Intergenic
1137926578 16:52546923-52546945 GCGGGAGAGCGGGAGGCGGCCGG + Exonic
1138179223 16:54931003-54931025 GCGGGCGCGGCGGTCGCAGCCGG + Exonic
1138619090 16:58197742-58197764 GCGGGACCGGGGGGCGGCGCGGG + Exonic
1139952705 16:70679891-70679913 GCGGGAGCGCAGGTCAGGGCCGG + Intronic
1140926566 16:79589798-79589820 GCGGGAGCTTGGGTGGGCGCGGG + Intronic
1141957748 16:87383805-87383827 GCGGGGGCGTGGCTCGGCGCTGG - Intronic
1142206387 16:88785057-88785079 GGCGGCGCGCGGGTCCCCGCGGG - Exonic
1203001695 16_KI270728v1_random:169033-169055 GTGGGAGCCCCAGTCGCCGCGGG + Intergenic
1203006732 16_KI270728v1_random:207446-207468 GCGGGAGCCCGAGTCGCCGCCGG + Intergenic
1203133299 16_KI270728v1_random:1705439-1705461 GTGGGAGCCCCAGTCGCCGCGGG + Intergenic
1203148247 16_KI270728v1_random:1816883-1816905 GCGGGAGCCCGAGTCGCCGCCGG - Intergenic
1203153226 16_KI270728v1_random:1855060-1855082 GTGGGAGCCCCAGTCGCCGCGGG - Intergenic
1142757255 17:2023828-2023850 GCGGGAGCTCAGGTAGCCGAGGG - Intronic
1142848071 17:2691699-2691721 GCGGGAGCCCCGCTCACCGCTGG - Intronic
1143608887 17:8006420-8006442 GCAGAAGCGCGGGCTGCCGCAGG + Exonic
1146283317 17:31559109-31559131 GCTGGAGCGGGCGTCGCGGCCGG + Intergenic
1147144569 17:38477659-38477681 GCGGGAGCCCGGGCCGGCGGCGG + Exonic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147210615 17:38870649-38870671 GCGGAAGCGCGGGGCGCTGGTGG + Intronic
1147620665 17:41864790-41864812 GCGGGAGCGCGGAGGGCGGCGGG - Intronic
1151218333 17:72592766-72592788 GCGGGTGCGCGGTGCGGCGCTGG - Intergenic
1152659764 17:81536814-81536836 GCGGGAGCGGGGGTGGCAGCGGG + Intronic
1152728760 17:81960037-81960059 GCGGGGGAACGGGACGCCGCGGG + Intronic
1153238920 18:3013365-3013387 GCGGGGGCGCGGCGCGCGGCCGG - Intergenic
1154133035 18:11752117-11752139 GCGAGGGCGCCGGTCTCCGCTGG - Intronic
1154241566 18:12657982-12658004 GCGGCCGCGCGCGCCGCCGCCGG + Exonic
1154355556 18:13621250-13621272 GCGGGAGGACGGGCTGCCGCAGG + Exonic
1155218398 18:23662836-23662858 GCGGGAGCGCGCGGCGTCGGAGG - Exonic
1157094848 18:44679131-44679153 GCGGCCGCGGGGATCGCCGCGGG - Intergenic
1157279026 18:46333938-46333960 GCGGGCGCGCGGGTGGCGGAGGG - Intronic
1159492287 18:69152631-69152653 GCGGGAGGGCGGGTGGCACCAGG + Intergenic
1159947830 18:74457225-74457247 GCGGGCGCGCGGGGCCCTGCCGG - Exonic
1160454825 18:78992904-78992926 GCGGGCGCGCTGGGCTCCGCAGG - Exonic
1160613967 18:80109728-80109750 GTGGGAGCGGGGGCCGCCCCGGG + Intronic
1160699158 19:497811-497833 GCGAGAGCCGCGGTCGCCGCAGG + Exonic
1160730559 19:639968-639990 GCGCGGGCGCCGGACGCCGCGGG + Exonic
1160788702 19:913058-913080 GCGGGCGGGCGGGGCGCGGCGGG - Intronic
1160831928 19:1108290-1108312 GCGGGGGCGGGGGGCGCGGCGGG - Exonic
1161264991 19:3359884-3359906 GCTGGCGCGCGGGGCGCCGCGGG + Intronic
1161820923 19:6531082-6531104 GCGCGAGCGCGGGGCGCGGGAGG - Exonic
1161960915 19:7522722-7522744 GCGGGAGCGCGGGACGCAGGCGG - Exonic
1162430507 19:10625593-10625615 GAGAGAGCGCGGGCGGCCGCCGG + Exonic
1162951375 19:14073646-14073668 GCGGGGGCGGGGGACGGCGCGGG + Exonic
1163282077 19:16324494-16324516 GCGGGAGCCCGGGGCGCCCGGGG + Intergenic
1165161695 19:33820413-33820435 TGGGGAGCCCGGGTCCCCGCAGG + Intergenic
1165349486 19:35268411-35268433 GCGCGAGCCCGGGGCTCCGCGGG - Intergenic
1165816763 19:38647459-38647481 GAGGGGGCGCGGCTCGCCCCCGG + Intergenic
1167074272 19:47239555-47239577 GCGGGGGCGCGGGCGTCCGCAGG + Intergenic
1167258061 19:48442870-48442892 GCGGCACCGCGGGGCGCAGCCGG + Exonic
1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG + Intergenic
927652315 2:24920096-24920118 GCGGGAGCGCGGGCCGAGCCCGG + Intergenic
930700670 2:54456253-54456275 GCGGGAGCGCGGGGGGCGGGGGG - Intergenic
931614657 2:64144054-64144076 GTGTGACCGCGGGGCGCCGCGGG - Intronic
931649384 2:64454445-64454467 GCGGGGGCGCGGGTCCGAGCTGG - Exonic
932152549 2:69386871-69386893 GCGGGAGAGGGGGTGGCGGCCGG - Intronic
934321374 2:91974714-91974736 GGGGCAGTGAGGGTCGCCGCGGG + Intergenic
934321421 2:91974904-91974926 GCGGGAGCCCGAGTCGCAGCCGG + Intergenic
937206510 2:120240074-120240096 GCGGGAGAGCGGGTGGCAGGAGG + Intronic
942454603 2:176129555-176129577 GCGGGAATGCGGATCGCAGCCGG - Intergenic
943646152 2:190408924-190408946 GCGAGGGCGCGGGTCGGCCCGGG - Intronic
943669785 2:190648845-190648867 GCGGGGGCGGGGGCGGCCGCTGG - Intronic
945879604 2:215312199-215312221 GCGGGAGCGTGGGGGGCCGCAGG - Intronic
948945665 2:241217903-241217925 GCGGGAGCGCGGGGCGGGGCGGG + Intronic
949004588 2:241637862-241637884 GCGGGAGCGCGGGGCGGTGTTGG + Intronic
1173807467 20:45935091-45935113 GCGGGAGCGCGCGGCGGGGCGGG + Intronic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1178561459 21:33642761-33642783 GCGGGGGCGGGGGTCGGCGCGGG + Intronic
1178961733 21:37072657-37072679 GCGGGGGCGCGGGTTGCGGACGG - Exonic
1179809922 21:43864461-43864483 GCGGGGGTGGGGGTCGCCCCGGG - Intergenic
1182211294 22:28679633-28679655 GCGGGAGCCAGAGTCGCCGCCGG - Exonic
1184153047 22:42649420-42649442 GCGGGCGCGCGGGGCGGGGCGGG + Intronic
1185133176 22:49052132-49052154 CCAGGAGCGCGTGTCCCCGCCGG + Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
950433857 3:12967288-12967310 GCGGGAGTGCGGGTGACCGTCGG - Intronic
952354198 3:32570143-32570165 GAGGGAGGGCGGGTCCCCGCAGG + Intronic
952382659 3:32817166-32817188 GCGGGGCCGCAGGTCCCCGCGGG - Intergenic
953657033 3:44862153-44862175 GCGGGCGGGCGGGGCGCCGCTGG + Intronic
954469028 3:50675460-50675482 GCGGGTGCGGGGGTGGGCGCGGG + Intronic
955911616 3:63864068-63864090 GCGGGAGCCCGGGCTGCAGCCGG - Intergenic
956322046 3:68008004-68008026 GCTGGAGCTCGGGCCGCCCCGGG + Intronic
958900132 3:99876258-99876280 GCGGGGGCGCCGGTGACCGCGGG + Intronic
961389106 3:126541944-126541966 GATGGCGCGCGGGTCGCCGCGGG - Exonic
965757518 3:172040562-172040584 GCGGGGGAGCGGGGCGCGGCGGG + Exonic
966712030 3:182980723-182980745 GCGGGGGCGGGGGGCGCGGCGGG + Intronic
967055206 3:185824671-185824693 GCGGGCGCGGGAGCCGCCGCCGG + Intronic
968230891 3:197003815-197003837 GAGGGAGCGGGGGGCGCTGCGGG - Intronic
968433896 4:575472-575494 GCGAGCGCGCGGGGCGCCGGGGG + Intergenic
968570815 4:1339620-1339642 GCGGCATCGCGGGTCACTGCAGG - Exonic
968965121 4:3765844-3765866 GCGGGCGCGCGGGGCGGGGCGGG - Intergenic
969379209 4:6783074-6783096 GAGGGAGACCGGGCCGCCGCCGG + Intronic
969715777 4:8867545-8867567 TCGGGAGCGCAGGCCGCGGCCGG - Exonic
970188193 4:13484396-13484418 GCGGGGCCGCCGGTCGGCGCGGG - Intergenic
975166862 4:71187200-71187222 GCGCGAGCCCGGGACGCGGCGGG - Intergenic
975778899 4:77819456-77819478 GCGGGAGCGAGGCCCGCCGTGGG - Intronic
977908184 4:102501233-102501255 GCGGGAGGTAGGGTCGCTGCCGG - Intergenic
984953214 4:185021277-185021299 ACGGGCGCCCGGGTCGCAGCTGG - Intergenic
985727554 5:1523996-1524018 GCGGGAGCGCCGGCCGGGGCGGG + Intergenic
985896098 5:2750933-2750955 GGGGGCGCGCGGGTCCCGGCCGG + Intronic
989229884 5:39074091-39074113 GAGGTAACGCGGGGCGCCGCGGG - Exonic
990383017 5:55233844-55233866 ACCGGAGCCCGGGTCGCTGCGGG + Intergenic
992269906 5:75053472-75053494 GGGGGAGCGAGGGTCGCCCGGGG - Intergenic
994366939 5:98928207-98928229 CTGGGAGCCCGGGTCGCGGCAGG + Intronic
995047888 5:107671010-107671032 GCTGCAGCGCGGGTCGGGGCAGG + Intergenic
998140467 5:139697106-139697128 GCTGGGGCGGGGGTGGCCGCGGG - Intergenic
1008629405 6:53348871-53348893 GAGGGAGCGCGGGTGGCAGCCGG + Exonic
1012170936 6:96016054-96016076 GCGGGGGCGCGGGGAGCTGCAGG - Exonic
1012895496 6:104941441-104941463 GCGGGAGGGCGGGGCGGGGCAGG + Intergenic
1016010771 6:139135559-139135581 GCGGGCGCGCCGGGCGCCGGAGG + Exonic
1019114853 6:169751764-169751786 GCGGGACCGCCGGCCACCGCAGG - Intronic
1019473394 7:1232960-1232982 GCGGGGGCGCGGGCCGGGGCCGG - Exonic
1020023480 7:4883176-4883198 GCGGGGGAGCGGGGCGCAGCGGG - Intronic
1020106232 7:5423486-5423508 CCGGGAGCCGGGGCCGCCGCCGG - Exonic
1022410373 7:30135095-30135117 GCGGGAGGGCGGGCGGCGGCGGG + Exonic
1023813001 7:43926739-43926761 GCGCGAGCGCGGGGCGGGGCCGG + Intronic
1025076950 7:55951879-55951901 CGGGGAGCGCCGGTCGCAGCGGG - Exonic
1029270680 7:99375050-99375072 GGGGGCGCGGGGGTGGCCGCAGG + Intronic
1030348222 7:108456357-108456379 GCGGGCGCGGGGGACGGCGCAGG - Exonic
1030348242 7:108456440-108456462 GCGGGGGCGCGCGCCGGCGCGGG - Intronic
1034435042 7:151059519-151059541 GCGGGAGCGGGGGCCGGGGCGGG - Intronic
1034911675 7:155002993-155003015 GTGGGGGCGCCGGGCGCCGCGGG - Exonic
1036176190 8:6540813-6540835 GCGGGAGGCAGGGGCGCCGCAGG + Intronic
1038176372 8:25184826-25184848 GCAGGAGCGCGGGGCGGCGGCGG + Intronic
1038554193 8:28494782-28494804 GCGGCAGCGCGGGGTGCCGGGGG + Intronic
1038727572 8:30095289-30095311 GCGGGTGTGCAGATCGCCGCCGG - Intergenic
1038727598 8:30095371-30095393 GCGCGAGCCCGAGTCGCCGGCGG + Intergenic
1038761061 8:30384588-30384610 GGAGGAGCGCGGGCCGCGGCTGG - Exonic
1040928902 8:52714202-52714224 GCGGGCGCCCGGGACGCCGGCGG - Exonic
1041166920 8:55101168-55101190 GCGGCGGCGCGGGGCGCGGCCGG - Intergenic
1043854173 8:85245716-85245738 GCGGGACCGCGGGGCGCCGGCGG - Exonic
1045277439 8:100721201-100721223 CCGGCAGCGCGGGTCCCCGCCGG + Intronic
1049452503 8:142669794-142669816 GCGGGCGCGCGGGGCGGGGCGGG - Intronic
1049708171 8:144052240-144052262 GCGCGGGCGCGGGTCCCAGCTGG - Exonic
1049803022 8:144526968-144526990 GCGGGGGAGCCGCTCGCCGCGGG - Exonic
1051404948 9:16727135-16727157 GCGGGAGAGCGGGCCGGAGCCGG + Intronic
1052295462 9:26892566-26892588 GCGGGAGCGCCGGGGGCTGCGGG - Exonic
1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1056732477 9:89178102-89178124 GCCGGGGCGCGGGGCGCCGAGGG + Exonic
1058508891 9:105694771-105694793 GGGTGAGTGCGGGGCGCCGCGGG + Exonic
1058887021 9:109329492-109329514 GCGGGAGCCCGTGTGGCCGCTGG - Intergenic
1059176728 9:112175132-112175154 GCGGGAGCGCCGGGCCCCGACGG - Exonic
1060514577 9:124257927-124257949 GCGGGCGCGCGGGCCCGCGCAGG + Intronic
1060855860 9:126914830-126914852 GCTGGAGCGCGGGCAGACGCGGG - Exonic
1061047973 9:128177624-128177646 GAGGGAGTGCTGGTAGCCGCAGG + Exonic
1061415573 9:130445222-130445244 GCGGGGGCGCGAGTCCCCGGGGG + Intronic
1061589851 9:131591294-131591316 GCGGGGGCGCGGGTGGACTCAGG + Intronic
1061681103 9:132242763-132242785 GCGGGAGCACTGGTCACCGCGGG + Exonic
1062277183 9:135736607-135736629 GCGGGAGCGCTCGGCGCGGCGGG - Intronic
1062561966 9:137145668-137145690 GTGGGAGGGCGGGTCCCCGCGGG + Intronic
1203794642 EBV:169893-169915 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203794843 EBV:170431-170453 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203795034 EBV:170954-170976 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203795235 EBV:171492-171514 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1187900908 X:24025754-24025776 GCCGGGACGCGGGGCGCCGCGGG - Intronic
1190024906 X:46913327-46913349 GCGGGAGCGCGGGCGCCCGGCGG + Intronic
1190554392 X:51618675-51618697 GCGGAAGCGCCGGTGGCGGCGGG - Intergenic
1197693021 X:129523054-129523076 GCGGGTGCGGGGGTCGGCGGCGG - Intronic
1200128760 X:153830196-153830218 GCGGGGGCGCGGCCCTCCGCGGG - Intronic
1201188902 Y:11430029-11430051 GCGGGAGCCCGAGTCGTCGCTGG + Intergenic