ID: 907052956

View in Genome Browser
Species Human (GRCh38)
Location 1:51342141-51342163
Sequence CCTGATTTGTAGGCTGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907052949_907052956 11 Left 907052949 1:51342107-51342129 CCACAAGTGGGGGCTATGGTATG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 907052956 1:51342141-51342163 CCTGATTTGTAGGCTGAGTAGGG 0: 1
1: 0
2: 1
3: 13
4: 148
907052947_907052956 15 Left 907052947 1:51342103-51342125 CCTACCACAAGTGGGGGCTATGG 0: 1
1: 0
2: 7
3: 115
4: 962
Right 907052956 1:51342141-51342163 CCTGATTTGTAGGCTGAGTAGGG 0: 1
1: 0
2: 1
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907052956 Original CRISPR CCTGATTTGTAGGCTGAGTA GGG Intronic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
904438486 1:30514725-30514747 CCTGCTGTGTAGGCTCAGTGAGG - Intergenic
905423860 1:37867768-37867790 CCTGATTTCTAGAGTGACTAGGG - Intronic
907052956 1:51342141-51342163 CCTGATTTGTAGGCTGAGTAGGG + Intronic
907612402 1:55885708-55885730 CCTGACTCGTAAACTGAGTATGG - Intergenic
908624996 1:66030356-66030378 CTGGATTTGTAGGATGAGTTAGG + Intronic
909862607 1:80627976-80627998 CTAGATTTGTAGAATGAGTAAGG + Intergenic
910199142 1:84680181-84680203 CCTGCTTTCTAAGCTGAGGATGG - Intronic
911955419 1:104227887-104227909 CTTGATTTGTAGCATGAGTAAGG + Intergenic
914444443 1:147738157-147738179 CATGATTTGTATGCTGGGAAGGG - Intergenic
915770247 1:158414681-158414703 CCTCATTTGTAGGCTGTTCAGGG + Intergenic
916748571 1:167703562-167703584 ACTGATGTGTAGGGTGAGTCTGG - Intronic
917820155 1:178754619-178754641 CTGGATTAGTAGACTGAGTAAGG - Intronic
922616268 1:226962962-226962984 CCTGATTTGGTGCCTGAGTGTGG + Intronic
924099352 1:240587863-240587885 CCTGATTTGTAGGCCTGTTAGGG + Intronic
924377572 1:243429638-243429660 CCTGCTTGGAAGGCTGAGGAGGG - Intronic
1062782208 10:223587-223609 CCTGTTTTCTAGGGTGAGGATGG + Intronic
1063277062 10:4581056-4581078 CCTTATTTAAAGGCTGAGGATGG + Intergenic
1063446026 10:6117898-6117920 CCTGTCTTGCAGGTTGAGTAGGG + Intergenic
1064187771 10:13177755-13177777 GCTGCTTGGTAGGCTGAGTGGGG + Intronic
1067732776 10:48824086-48824108 CCTGATTTGTAGCCTTAGCATGG - Intronic
1068265247 10:54639971-54639993 GCTGATCTGGAGGCTGAGGAAGG + Intronic
1068736730 10:60421643-60421665 CCTGCTTTTTAGGGTGAGGATGG - Intronic
1072858311 10:98973998-98974020 AATGATTTGTAGGCTGGGCATGG + Intronic
1073150345 10:101307097-101307119 CCTGATATCAAGGCTAAGTAGGG + Intergenic
1075702464 10:124478260-124478282 CCTGCTTTGTAGGATGATCAGGG + Intronic
1078254679 11:9647882-9647904 CATGATGAGTAGGCTGAGGAGGG + Intergenic
1080639356 11:34149779-34149801 CTTGCTTTCTAGGCTGGGTACGG + Intergenic
1087092641 11:94289803-94289825 CCTAATTTGTAGGCTTATTACGG - Intergenic
1087303121 11:96458360-96458382 CCTGATCTCTAGGCTGTCTAAGG + Intronic
1088325567 11:108597307-108597329 CCTAATTGGGAGGCTGAGGAAGG - Intergenic
1088771993 11:113044392-113044414 CATGATTTGTAGGCTGGGTGTGG + Intronic
1090410441 11:126504645-126504667 CTGGTTTTGTAGGATGAGTAGGG - Intronic
1095989778 12:48026807-48026829 CTTGATCTGTTGGCTGATTATGG + Intergenic
1098196899 12:68011820-68011842 CTTGCCTTGTAGGCTGAGCAGGG - Intergenic
1101962252 12:109259003-109259025 GCGGTTTTGTAGGCTGAGTCTGG - Exonic
1103436262 12:120929289-120929311 CCTGACTTGAGGGCTGAGTCTGG - Intergenic
1105346809 13:19580725-19580747 CCTGACTTTTAGGCTGAGCACGG + Intergenic
1105746631 13:23383306-23383328 CCTGAGTGGTGGCCTGAGTAAGG - Intronic
1106665764 13:31848606-31848628 TCTGATTTATAGGCTGGGGATGG - Intergenic
1106873683 13:34048962-34048984 CCTACTTTGGAGGCTGAGTTGGG + Intergenic
1107150552 13:37105775-37105797 CCTGATTTGTTGGGTAAGAAAGG + Intergenic
1113500638 13:110771163-110771185 GCTGCTTAGTAGGCTGAGGAGGG - Intergenic
1116158879 14:41240939-41240961 TCTGATATGGAGGCTGAATAGGG - Intergenic
1117810511 14:59540815-59540837 CATAATTTGTATGCTCAGTAAGG + Intronic
1118501387 14:66365620-66365642 CCTGAGTTGTAGCATGAGAAAGG + Intergenic
1120520634 14:85523898-85523920 CCTGTTTTGTAGGTTGACAAAGG - Intergenic
1121205918 14:92167300-92167322 GCTGAATCTTAGGCTGAGTATGG - Exonic
1123052334 14:105550930-105550952 CCTGGATTGTAGGCTGGGCATGG + Intergenic
1124082859 15:26517463-26517485 CCTGATTGGGAGGCTGAGGTGGG - Intergenic
1124342042 15:28895820-28895842 TCTGATTTGAAGGCTGGGCATGG + Intronic
1124981809 15:34574592-34574614 TCTGATTTGAAGGCTGGGCACGG - Intronic
1125568248 15:40694346-40694368 CCGGTTTTAAAGGCTGAGTAGGG - Intergenic
1126675842 15:51158777-51158799 CATGATTTATAGGCTGAGATTGG + Intergenic
1128699781 15:69795821-69795843 TCTGATTGGAAGGCTTAGTAAGG - Intergenic
1128944160 15:71810178-71810200 CCTGATTGGGAGGCTGAGGCAGG + Intronic
1129838285 15:78727506-78727528 CAGGATGTGAAGGCTGAGTATGG - Intronic
1129999642 15:80035567-80035589 CCAGATGTGAAGGCTGAGTTTGG + Intergenic
1130136657 15:81187349-81187371 ACACTTTTGTAGGCTGAGTAGGG + Intronic
1131298041 15:91169440-91169462 CCTGTTTTGTAGGCTATTTAAGG + Intronic
1134403770 16:13937204-13937226 CCTGGTTTTTAGGCTGGGCACGG - Intronic
1140493776 16:75365139-75365161 TCTGATTTGTAAGCTGTTTATGG - Intronic
1140939024 16:79703521-79703543 CTTGATTTGTAAGCTGGGCACGG - Intergenic
1140995528 16:80255522-80255544 CCTGATTTAGGGGCTGATTATGG - Intergenic
1142215916 16:88829744-88829766 CCTGATGTGTAGAATGAGTGGGG + Intronic
1148505437 17:48123410-48123432 GCTGTTTTTTTGGCTGAGTAGGG - Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153878238 18:9396012-9396034 ACTGATTTGAAGGCTGGGTCAGG - Intronic
1159349809 18:67258089-67258111 CCTGTTTTGCAGGCTGGGGAGGG + Intergenic
1159467047 18:68797221-68797243 CCTAATTTGTAGGCTTATTACGG - Intronic
1160124744 18:76161220-76161242 CCTGATTTGGAGTCAGAGAAAGG - Intergenic
1162267381 19:9586851-9586873 AGTGATTTCTTGGCTGAGTAAGG + Intergenic
1162272274 19:9625955-9625977 AGTGATTTCTTGGCTGAGTAAGG + Intronic
1162279186 19:9681278-9681300 AGTGATTTCTTGGCTGAGTAAGG + Intergenic
1166239335 19:41479051-41479073 TCTGAGTTGTACGCTGAGGAGGG - Intergenic
1167012333 19:46816768-46816790 AATGTTTTGTAGGCTGGGTATGG + Intergenic
925239314 2:2309138-2309160 GCTGAAGTGTAGGCAGAGTATGG - Intronic
926614761 2:14984837-14984859 CTGGATGTGTAGGCTGAGTGGGG + Intergenic
930875910 2:56215835-56215857 CATGACTTGTAAGCTGAGAATGG + Intronic
931597285 2:63962155-63962177 CCTGTACTGTAGGCTGAGTCTGG + Exonic
933277709 2:80301542-80301564 TCTGCTTTAAAGGCTGAGTAAGG + Intronic
933859258 2:86448216-86448238 CATGTTTTGTTGGCTGAGAAGGG + Intronic
935702553 2:105824999-105825021 CCACATTTGTTGGCTGAGTGGGG + Intronic
938317252 2:130338692-130338714 CCTGATCTTTTGGCTGAGTACGG + Exonic
938386209 2:130869100-130869122 CCCTCTTGGTAGGCTGAGTAGGG - Intronic
939396185 2:141632321-141632343 CCAGATTTCTAGGTTGGGTAGGG - Intronic
940443264 2:153744964-153744986 CCTGGTTTGCAGGCAGAGCATGG + Intergenic
940924787 2:159352595-159352617 GCTAATTTGGAGGCTGAGTTGGG - Intronic
944735965 2:202565109-202565131 TCTGATTTGTAGTCTGTGTCAGG + Exonic
947285390 2:228508144-228508166 TCTGTTTTGAAGGCTGAGTCAGG + Intergenic
1170225197 20:13984300-13984322 CCTGATTTCAAGGCTGAGTGCGG - Intronic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173705300 20:45105879-45105901 CCTGGTTTCTAGGCTGAGTTAGG + Intergenic
1173719018 20:45237057-45237079 CCTGCTATGTGGGCTGAGTGGGG - Intergenic
1177305250 21:19306779-19306801 GCTGATTTGAAGGATGAATAAGG - Intergenic
1178128909 21:29547124-29547146 CCTGGTCTGTAGGCTCATTAAGG + Intronic
1178164124 21:29952483-29952505 CCATATGTGTAGACTGAGTATGG - Intergenic
1182461286 22:30485735-30485757 CCTCATCTGTAGGCTGCGGATGG + Intergenic
1184180364 22:42819212-42819234 CCTGTTCTGTAGGAAGAGTAAGG - Intronic
1184897853 22:47422500-47422522 CCAGTTTTGCAGGCTGCGTATGG + Intergenic
950150142 3:10680576-10680598 TCTGACTTGTGTGCTGAGTATGG - Intronic
950463850 3:13141697-13141719 CCTGATATGTAGGTCGAGGAGGG - Intergenic
953401460 3:42623873-42623895 CCTGCTTTATAGGCTCAATAAGG + Intronic
958980708 3:100715860-100715882 TCTGAATTGTAGGCTGGGCATGG - Intronic
960192254 3:114720914-114720936 ACTGATATGTAGGCTGACAAAGG + Intronic
963827772 3:149972259-149972281 CATGATTTGTAGGAGGATTAAGG + Intronic
970627535 4:17905127-17905149 TCTGATTGGGTGGCTGAGTAAGG + Intronic
971407574 4:26336403-26336425 GCAGATTTGGAGGCTGAGGAAGG + Intronic
975462441 4:74670176-74670198 TCTAATGTGTAGGCTGAGTTGGG + Intergenic
975567170 4:75770052-75770074 TCTGAATTGTAGTCTGAGTTTGG + Intronic
979524266 4:121701264-121701286 CCTGGTATGCAGGCAGAGTAGGG - Intergenic
979706959 4:123731743-123731765 GCTGATTTGTAGAATGAGTTAGG + Intergenic
980406027 4:132354905-132354927 CCTGACTGGTAGGGTGATTATGG - Intergenic
982789629 4:159575996-159576018 CCTGGTTGGTAGGCTTAGTAAGG + Intergenic
985001877 4:185493349-185493371 CCTGATCTGTTGGCTAACTAGGG + Intergenic
985217117 4:187665612-187665634 CCTGATTTGTAGACTGCATGTGG - Intergenic
986827820 5:11540754-11540776 CATGATTGGTAGGCTGAGGTGGG - Intronic
987466852 5:18282222-18282244 CTTGATTTGTATTCAGAGTATGG + Intergenic
988599697 5:32628202-32628224 CCTGCTTGGTCGGCTGTGTAAGG + Intergenic
990204811 5:53417197-53417219 ACTGATATGTAGGCTGGGTGCGG - Intergenic
991996912 5:72396998-72397020 CATGCTTTGAAGGCTGAGTATGG - Intergenic
993905942 5:93622696-93622718 CCTCATTTTTAGTCTGAGTTGGG - Intronic
994777327 5:104050646-104050668 GCTGAGTTGTTGGCTGAGTTTGG - Intergenic
997545626 5:134704689-134704711 CCTACTTGGGAGGCTGAGTAGGG + Intronic
998189018 5:140006657-140006679 CCTGATTTGGTGTGTGAGTATGG + Intronic
1005698059 6:28369939-28369961 CCTGATCTGTAAGCAGGGTAGGG - Intergenic
1007114570 6:39334504-39334526 CAGGAGTTGGAGGCTGAGTATGG + Exonic
1010453754 6:76031059-76031081 GATGGTTTGAAGGCTGAGTAAGG - Intronic
1012409344 6:98938327-98938349 CCTGATCTGGAGGCTGAATTAGG + Intronic
1013978625 6:116103980-116104002 CATAATTTGTAGGCTGCATATGG + Intronic
1013987790 6:116216970-116216992 CCTTATTTGGAGGCTGACCATGG + Intronic
1017052152 6:150403405-150403427 CCTATTTTGTGGGCTGAGTGGGG - Exonic
1017690358 6:156957795-156957817 CCTCATTTGCTGGATGAGTAGGG + Intronic
1020719607 7:11724841-11724863 CCTGCTGTGGAGGCTGAGTGTGG + Intronic
1021309526 7:19076254-19076276 CCAGTTTTGTAGGATGAGTTAGG - Intronic
1021616295 7:22506285-22506307 CCTCATTTGTATCCTCAGTATGG - Intronic
1023526462 7:41108407-41108429 CCTGATTTGGGGGCTGTGTGTGG + Intergenic
1025333598 7:58355972-58355994 CCTGTTTTGTAGGCTATTTAAGG - Intergenic
1025767489 7:64469091-64469113 TCTAATGTATAGGCTGAGTATGG - Intergenic
1026215576 7:68345893-68345915 ACTTATTTCTAGGCTGGGTATGG + Intergenic
1026831185 7:73611163-73611185 CCTGAATTGTGGGCAGAGGAGGG - Intronic
1028376167 7:90148052-90148074 CCTCATTTGTATCCTCAGTATGG + Intergenic
1029824097 7:103172188-103172210 CCTCATTTGTATCCTCAGTATGG - Intergenic
1029903811 7:104070671-104070693 ACTGATTTGTTGGCAGAGCATGG - Intergenic
1031991528 7:128202104-128202126 GCTGATTTGTAGGCACAGGAAGG - Intergenic
1035261632 7:157665212-157665234 CGTGATTGTTAGGCTGAGTCTGG - Intronic
1036168291 8:6458180-6458202 CCTGATTTGCGGGCTGGGTGCGG + Intronic
1037348787 8:17927240-17927262 GCTGTTTGGTAGGCTGAGTAAGG - Intronic
1040397959 8:47017370-47017392 CCTCATTTGTATTCTGGGTAAGG + Intergenic
1043180390 8:77081677-77081699 TCTGATTTGTTGGCTGAGTGAGG - Intergenic
1044493253 8:92846193-92846215 CCTGATTTGTATGATCAGTTGGG + Intergenic
1047346918 8:124037796-124037818 CCTGATTGGCAGGGTGAGGAGGG - Intronic
1048496136 8:134937727-134937749 GCTGATTTGGAGGCTGAGGTGGG + Intergenic
1048807496 8:138254366-138254388 GCTGATTTCTAGGCTGAGCTTGG + Intronic
1053295600 9:36910858-36910880 CCTGATTTATGGGCTGAGCCTGG + Intronic
1057138465 9:92711920-92711942 CCTGTTTTGTTTGCTGAGTGAGG - Exonic
1057747774 9:97765561-97765583 CCTTGTTTCTAGGCAGAGTAAGG - Intergenic
1058197684 9:101999027-101999049 TCTGAATTGTAGGTGGAGTAGGG + Intergenic
1059882432 9:118706260-118706282 CTTGATTTGTAGGCTGAGTCTGG - Intergenic
1060119386 9:120973865-120973887 CCTGCTTTGGAGGCTGAGGCAGG + Intronic
1189013364 X:37070301-37070323 CCTGATTGGGAGGCTGAGGCAGG + Intergenic
1191860984 X:65666749-65666771 TCTGAGTTTTAGGCTGAGTGCGG - Intronic
1195522261 X:105844821-105844843 CCTGTTTTGTAGAGTGAGGAAGG - Intronic