ID: 907053073

View in Genome Browser
Species Human (GRCh38)
Location 1:51342833-51342855
Sequence CAGGCTGAGGAGAAGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 413}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907053073 Original CRISPR CAGGCTGAGGAGAAGGTGTA GGG (reversed) Intronic
901063836 1:6485662-6485684 CAGGCGGAGGCGGGGGTGTAGGG - Intronic
902690172 1:18106098-18106120 CAGCCTGAGAAGAAGGTGAGGGG + Intergenic
903780078 1:25815365-25815387 CAGGGTGATGAGATGGTGTCGGG + Intronic
904932429 1:34099938-34099960 TTGGCTGATGAGAAGGTGGAAGG + Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
905209884 1:36366713-36366735 CAGCCTGAGGACCAGGTGTCTGG - Intronic
905454173 1:38076181-38076203 CAGGCTGAAGAGAAGCTTCAGGG - Intergenic
905726894 1:40259711-40259733 AAGGCTGAGGTGGAGGTGGAGGG - Intronic
905770940 1:40637372-40637394 CAGGCTGAGAACAGGGTGCAGGG + Intronic
906294765 1:44642806-44642828 CAGGCCGAGCAGAAGATGTGAGG + Intronic
906520658 1:46465111-46465133 CAGGCTGAGGAGACAGTTAATGG + Intergenic
907053073 1:51342833-51342855 CAGGCTGAGGAGAAGGTGTAGGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908305367 1:62808698-62808720 TAGCCTGAGTAGAGGGTGTAGGG + Intronic
908602158 1:65752309-65752331 GGGGCTGAGGACAAGGTGCAGGG - Intergenic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
909033335 1:70567499-70567521 CAGGCTCAGGAGAGAGTGTAAGG + Intergenic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
912848762 1:113103192-113103214 TAGGCCTAGGAGAAGGTTTAAGG - Intronic
913360633 1:117976527-117976549 CAGGCTGAGCAGAGGCTGTGAGG + Intronic
914244647 1:145876636-145876658 GAGGCTGGGGAGAAGATGTTTGG + Exonic
916986900 1:170201473-170201495 CAGGGTGGGGTGGAGGTGTATGG + Intergenic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
917584287 1:176410118-176410140 CTGGCTGTGGAGATGGTGCAAGG + Intergenic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
919914323 1:202130402-202130424 CAGGCTGAGGCCAAGGGGTGTGG - Exonic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
922471131 1:225877993-225878015 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
924384214 1:243487627-243487649 CAGGTTCTGGAGAAAGTGTAAGG - Intronic
1062799871 10:371156-371178 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1062799877 10:371174-371196 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1064133038 10:12727024-12727046 CAGGCTGAGGATAACGCGGAAGG - Intronic
1064444921 10:15384592-15384614 CAGGAGGAGGAGATGGTGAAAGG + Intergenic
1065232297 10:23610819-23610841 CAGGGTGTGGAAAAGCTGTAAGG - Intergenic
1066572176 10:36785454-36785476 TAGTCTGAGGACAAGGTGTGGGG + Intergenic
1067073888 10:43161662-43161684 CAGGAGGAGGAGCTGGTGTAGGG - Intronic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1069132899 10:64728424-64728446 GAGCCTCAGGACAAGGTGTATGG - Intergenic
1069578228 10:69545469-69545491 GAGGCTGAGGGGAAGGGCTAAGG + Intergenic
1071324692 10:84501428-84501450 CTAGCTGAGGAGAAGGAGAAAGG - Intronic
1071550887 10:86565326-86565348 CAGCCTGGGGAGAAGGGGAAAGG + Intergenic
1072919018 10:99559836-99559858 GAGGCTGAGGAAAGGGTGAATGG - Intergenic
1072944166 10:99794957-99794979 GATGCTGAGGAGAAGATGGAGGG + Intronic
1073078883 10:100844107-100844129 TAGGCTGAGGAGAAGGAGGGAGG - Intergenic
1073220125 10:101864743-101864765 CAGGCTGGGGAGAGGGGGAAGGG + Intronic
1074531669 10:114302562-114302584 CAGGCTCAGGGGTAGGGGTACGG - Intronic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075095152 10:119466367-119466389 CAGGCTGAGAGGAAGGGGTGAGG - Intergenic
1076978743 11:194091-194113 CAGACTGGGGAGGAGGTCTATGG - Intronic
1077020149 11:413760-413782 CAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077020177 11:413844-413866 CAGGCAGAGGAGAGGGTTCAGGG - Intronic
1077020198 11:413900-413922 CAGGCAGAAGAGAGGGTGCAGGG - Intronic
1077020256 11:414107-414129 TAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077020284 11:414191-414213 TAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077020312 11:414275-414297 TAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077187109 11:1240333-1240355 CAGGCGGTGGTGAAGGTGAATGG - Exonic
1077491809 11:2864431-2864453 CACCCTGAGGGGAAGGTGGATGG - Intergenic
1078306564 11:10193968-10193990 CAGGATCAGGAGAAGGTCTGGGG - Exonic
1078526396 11:12104805-12104827 CAGGCAGATGGGAAGGAGTATGG - Intronic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079524213 11:21364812-21364834 CAGGGAGATGAGAAGGTGAAGGG + Intronic
1079824587 11:25175026-25175048 CAGGCTGTGGCAAAGGTGAATGG - Intergenic
1079915999 11:26369408-26369430 AAGGATGAGGAGAATGAGTAGGG - Intronic
1080529534 11:33161499-33161521 CCGGCCGAGGAGGAGGTGTGTGG + Intronic
1080953452 11:37064426-37064448 GAGGCTGAGTAGGAGGTGTTTGG + Intergenic
1083679103 11:64343092-64343114 CAGGCTGAGGGGAAGGAGTTTGG + Intronic
1084266936 11:68010024-68010046 CAGCCTGAGGAGGAGGAGTGGGG - Intronic
1084459025 11:69286031-69286053 CAGGCTGAGGGGCAGCTGCAGGG - Intergenic
1084658908 11:70535842-70535864 GAGCCTGAGAAGAAGGTGTCAGG + Intronic
1085027719 11:73246708-73246730 TAGGCTGAGGAAAAGGTGGAAGG - Intergenic
1085200668 11:74699887-74699909 CAGGGTGAGGAGATGGGGTGCGG + Intronic
1087617631 11:100506586-100506608 GAGGCTGAAGAGGAGGTGAAGGG - Intergenic
1088590158 11:111396039-111396061 GGGGCTGAGGAGAAGGTTGAGGG - Intronic
1088836138 11:113579214-113579236 CAAGCTGAGGTTTAGGTGTATGG - Intergenic
1089419441 11:118320106-118320128 CAGGTTGAGGAGATGGTTTGAGG - Intergenic
1089502399 11:118940305-118940327 CAGGCTGGGGAGGAGGTGCAGGG + Intronic
1090178563 11:124673600-124673622 CAGGCTGAGGGGCAGGGGTCCGG + Intronic
1090855581 11:130607319-130607341 AAGGCTGAGGAGGAGGTGGAGGG + Intergenic
1090867744 11:130716924-130716946 CAGGTGGAGGAGAAGGTGAAGGG - Exonic
1092969342 12:13676973-13676995 TGGGCTGAGGTGAAGGTGTCCGG - Intronic
1093019075 12:14186462-14186484 GAGGCTGAGGTGGAGGTGGAAGG - Intergenic
1095311645 12:40705344-40705366 CAAGCTGAGCAGAAGGTCTATGG - Intronic
1096219689 12:49821260-49821282 CAGGCTGAGGGGAAGTTGGGGGG - Intronic
1096547816 12:52353095-52353117 CAGGGAGAGGAGAGAGTGTACGG - Intergenic
1096555089 12:52398924-52398946 CAGGCTGAGCAGCAGGTGCTAGG - Intronic
1098583900 12:72133844-72133866 AAAGCTGAGGAGGAGGTGAAAGG - Intronic
1098826813 12:75306959-75306981 CACTCAGAGGAGAAGGAGTAAGG + Intronic
1099970215 12:89492661-89492683 CAGGATGAGGTGCAGGTGTATGG - Intronic
1101081591 12:101191981-101192003 CAGGCTGAGGAGAGAGGGTATGG - Intronic
1101997980 12:109538702-109538724 CAGGGTGAGGAGATGCTGGATGG + Intergenic
1103059539 12:117847621-117847643 TAGGCTGAACAGAAGGTGTCTGG - Intronic
1103858855 12:123995544-123995566 CAGGCTTTGGAGAAGGAGAATGG + Intronic
1104033292 12:125080590-125080612 CAGGCTAAGGTAAAGGGGTAGGG - Intronic
1104477748 12:129084448-129084470 CAGGCTAAGGAGGAAGTGTACGG - Intronic
1104617810 12:130285010-130285032 CAGGCTGAGGTGGAGGTGGGGGG + Intergenic
1105272990 13:18895086-18895108 CACGCTGACCAGAAGGTGTATGG + Intergenic
1105303919 13:19156290-19156312 CAGGATGAAGAGCAGGTGGAAGG - Intergenic
1105546074 13:21352054-21352076 CAGGCTGCTGAGGAGGTGTCGGG - Intergenic
1105666014 13:22557364-22557386 CAGGAGGAGGAGAAGGAATATGG + Intergenic
1106335271 13:28777974-28777996 GAGGCTCAGGAGAAGGTGGCAGG + Intergenic
1106391462 13:29339037-29339059 GAGGCTCAGGAGAAGGTGGCAGG + Intronic
1107374854 13:39792547-39792569 TAGGCTGAGGAGGAGGAGAAAGG + Intergenic
1108007512 13:45965279-45965301 CAGGATGAGGAGAAGATGCCAGG - Exonic
1109888775 13:68579324-68579346 CAAGCTGAAGAGAATGTTTAAGG + Intergenic
1110042897 13:70787867-70787889 CAGGCTATGAAGCAGGTGTAAGG + Intergenic
1112201131 13:97276066-97276088 CAGGATGATGAGAGAGTGTATGG - Exonic
1113508209 13:110831581-110831603 CAGGCTGGGGAGAACCTGTGTGG - Intergenic
1113975946 13:114227344-114227366 AAGGCTGAGGAGAAATTTTAAGG + Intergenic
1114439017 14:22731295-22731317 CAGGCTGAGGAGAGTGTGACAGG - Intergenic
1115193016 14:30767615-30767637 CATGCTGAGGAGACGGTGAGGGG + Intergenic
1116123379 14:40750210-40750232 CAGGATGAGGCGATTGTGTATGG + Intergenic
1117318742 14:54600221-54600243 CATGCTCAGGAGAAGGTGCCTGG - Intronic
1118201672 14:63679870-63679892 CAGGAGGAAGAGAAGGTGAAGGG + Intergenic
1118346009 14:64941438-64941460 TAGGCTGAAGAGATGGTGTGAGG + Intronic
1118708169 14:68499069-68499091 CAAGAAGAGGAGAAGGTGAAGGG + Intronic
1118896497 14:69949812-69949834 CAGGCCGGGGAGACGATGTAAGG + Intronic
1119114504 14:72006853-72006875 CGGGCTGTGGAAAAGCTGTAAGG + Intronic
1120533682 14:85665924-85665946 AAAGCTGTGGAGAAGGTATATGG - Intergenic
1120537112 14:85710629-85710651 GATTCTGAGGTGAAGGTGTAGGG - Intergenic
1120696093 14:87647361-87647383 CAGGCAGAAGAGTATGTGTAGGG + Intergenic
1120706191 14:87748297-87748319 CTGGCTAATGAGATGGTGTAAGG - Intergenic
1121654963 14:95588415-95588437 CAGGATGAGGAGGGGGTGTGAGG + Intergenic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1121806541 14:96830917-96830939 CAGGCTGAGGAGAAACTGCTAGG - Intronic
1121888756 14:97569596-97569618 CAGGCAGAGGGAATGGTGTATGG - Intergenic
1121897743 14:97664279-97664301 CAGGCTTGGGAGAAGAAGTATGG - Intergenic
1122428132 14:101623454-101623476 GAGGCAGGGGAGAAGGTGTGAGG + Intergenic
1123475805 15:20592123-20592145 GAGGCTGAGGACAAGGTGTCAGG - Intergenic
1123642205 15:22408240-22408262 GAGGCTGAGGACAAGGTGTCAGG + Intergenic
1126380184 15:48038571-48038593 CAGGCTGAAGGAAAGGAGTAAGG + Intergenic
1126562740 15:50061341-50061363 CAGGCTGAGGAAAAGGAATAGGG + Intronic
1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG + Intergenic
1127294086 15:57594443-57594465 CAGGATGAGTAGAATTTGTAGGG + Intronic
1127378448 15:58406775-58406797 CAGGCTGAGGAGATGGGGTGGGG - Intronic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1127401437 15:58590263-58590285 CATGCTGAGGAGGAGGTTTTTGG - Exonic
1128545677 15:68566092-68566114 CTGGATGAGGAGAAGGGGTTGGG + Intergenic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1129115238 15:73361973-73361995 CTGGCTGGGGAGAAGGCGCAGGG - Intronic
1129626273 15:77203196-77203218 CAGGCAGAAGAGGAGGTGGAAGG + Intronic
1130959452 15:88650060-88650082 CAGGCTACGGGGAAGGTGTTAGG + Intronic
1131108606 15:89750675-89750697 CAGGCTGAGGGGCAGGGGCAGGG - Exonic
1131748839 15:95482900-95482922 CAGCCTGAGGTGAAAGAGTAAGG - Intergenic
1133869694 16:9675545-9675567 CAGGCTGGGGAGGAGGGGAAAGG + Intronic
1133996491 16:10752395-10752417 CAGGCTGAGGGGTAGGGGAATGG + Intronic
1134378397 16:13701229-13701251 CAGGCCCAGGAGAAGGGGTAAGG - Intergenic
1134665765 16:16017561-16017583 CAAGTTGGGGAGCAGGTGTAGGG - Intronic
1135824832 16:25717488-25717510 AAGGATGAGTAGAAGGTGAAGGG + Intronic
1136232545 16:28895081-28895103 CAGCCTGTGGAGAAGCTGCAGGG - Intronic
1136723812 16:32342019-32342041 CAGGGTCAGGACAAGGGGTAGGG + Intergenic
1136842141 16:33548063-33548085 CAGGGTCAGGACAAGGGGTAGGG + Intergenic
1137597486 16:49734469-49734491 CAGGCCGAGGAGAAGGCCAATGG + Intronic
1137886179 16:52106026-52106048 CATGCTCTGGAGAAGATGTAAGG + Intergenic
1139325329 16:66148285-66148307 CAGGGTGGGGAGTGGGTGTAGGG - Intergenic
1139521811 16:67487041-67487063 CAGGGAGAGGAGAAGATGGATGG + Intergenic
1139653345 16:68373552-68373574 CAGGAGGAGGAGAGGGTGTGGGG - Intronic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140479147 16:75253222-75253244 CAGGCTGAGGAGTGGGTGGCTGG - Intronic
1140492019 16:75345410-75345432 CAGGCTGAGGTAAAGTGGTACGG - Intronic
1140606262 16:76542579-76542601 CAGGATGAGGCAAAGATGTAGGG + Intronic
1141107581 16:81246195-81246217 CAGTCAGAGGAGGAGGTGTGAGG - Intronic
1203002619 16_KI270728v1_random:175746-175768 CAGGGTCAGGACAAGGGGTAGGG - Intergenic
1203134225 16_KI270728v1_random:1712152-1712174 CAGGGTCAGGACAAGGGGTAGGG - Intergenic
1203152306 16_KI270728v1_random:1848360-1848382 CAGGGTCAGGACAAGGGGTAGGG + Intergenic
1142466172 17:138582-138604 CAGACTGGGGAGGAGGTCTATGG - Intronic
1143242525 17:5455897-5455919 CAGGCTCCAGATAAGGTGTATGG - Intronic
1143622592 17:8089353-8089375 CAGGATAGGGAGAAGGTGTTAGG + Intergenic
1143804621 17:9416118-9416140 AGGGCTGAGAAGCAGGTGTAAGG - Intronic
1143852855 17:9825762-9825784 CAGGCTGAGGAGAAAGAACAAGG - Exonic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1145810069 17:27759220-27759242 CAGGCTCAGGATGAGGTGCATGG + Intronic
1146083837 17:29808768-29808790 CAGGCTGAGGAGCTGTTATATGG + Intronic
1146308468 17:31748821-31748843 GAGGTTGAGGAAAAGGAGTAGGG + Intergenic
1146538373 17:33673136-33673158 CAGGCTCAGGTGCAGGTGCAGGG + Intronic
1146621677 17:34403530-34403552 TCGGCTTAGGAGAAGGTGTTTGG + Intergenic
1147992580 17:44344106-44344128 CAGGTGGAGGAGGAGGTGTTGGG - Intergenic
1148001303 17:44389102-44389124 CTGGCTCAGGTGAAGGTATAAGG - Intronic
1148383901 17:47220935-47220957 CAGCCAGAGGAGAAGGGGGACGG - Intronic
1148548344 17:48533630-48533652 CGGGATGAGGAAAAGGTGGAAGG - Intergenic
1148741801 17:49897350-49897372 AGGGCTGGGGAGAAGGTGAAGGG - Intergenic
1149190946 17:54061011-54061033 CAGCCAGAGAAGAAGGAGTAAGG - Intergenic
1149542231 17:57476318-57476340 CAGGCTCAGGGGAAGGTGCCAGG - Intronic
1149747646 17:59114711-59114733 GAGGCTGAAGGGAAGTTGTAAGG + Intronic
1149819851 17:59765685-59765707 GAGGCTGAGGAGGAGGCGGAGGG + Intronic
1150656232 17:67041643-67041665 CTGGCTGCGGAGCAGGTGGAAGG - Intergenic
1151622397 17:75254208-75254230 CAGCCTGAGGAGAAGGGGAAAGG - Intronic
1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG + Intergenic
1152059779 17:78063381-78063403 CAGGCTGAGGAGGAAGGGGAGGG + Intronic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152927792 17:83095559-83095581 CCGGCTGAGGAGAAGACGAAGGG - Intergenic
1152927800 17:83095588-83095610 CCGGCTGAGGAGAAGACGAAGGG - Intergenic
1152927817 17:83095646-83095668 CTGGCTGAGGAGAAGACGAAGGG - Intergenic
1152927827 17:83095676-83095698 GAGGCTGAGGAGAAGATGAAGGG - Intergenic
1152927866 17:83095815-83095837 CTGGCAGAGGAGAAGATGAAGGG - Intergenic
1153220133 18:2853969-2853991 CAGGCTGAGCAGGAGGTGATGGG - Intronic
1153245580 18:3070189-3070211 CAGGCTGAAGTGAAGTGGTATGG + Intronic
1153706387 18:7749637-7749659 CAGTGTGAGGAGGTGGTGTATGG + Intronic
1153797508 18:8637981-8638003 GAGGCGGAGGAGAAGGTGAGTGG + Intronic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1156967607 18:43114261-43114283 TAGGGTGAGGAGAAGAGGTAGGG + Intronic
1157473031 18:48004126-48004148 CAGGCTGGGGAGGAAGTGTTGGG + Intergenic
1157475196 18:48019610-48019632 CAGCCTGAGGGGACAGTGTAGGG + Intergenic
1157831150 18:50858034-50858056 CAGGTTGAGAAGCAGGTGTGAGG - Intergenic
1158385888 18:56991126-56991148 AAAAATGAGGAGAAGGTGTACGG - Intronic
1159074520 18:63665534-63665556 CAAGCTGAGGAGAATGTATGTGG + Intronic
1159093159 18:63871827-63871849 GAGGCTGAGGAGTAGGGGTTTGG + Intronic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1160237484 18:77097566-77097588 CAGGCTGTGTAGAAGATGTCTGG - Intronic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1161650305 19:5480225-5480247 CAGGCTGAGGACAAGGTCGTGGG + Intergenic
1162479711 19:10921227-10921249 CAGGAAGAGGAAAAGGTGAAAGG - Intronic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1163768779 19:19178355-19178377 CAGGCTGGGGAGCAGGGGCAAGG + Intronic
1164072122 19:21777956-21777978 CAGGCAGAGGAAATAGTGTAAGG - Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1165951432 19:39475779-39475801 CAGGAAGAGGAGCAGGTGTGGGG + Intronic
1166141017 19:40805249-40805271 CGGGCTGGGGAGAAGTTGAAGGG + Intronic
1166301357 19:41913595-41913617 CAGGGTGAGCAGCAGGTCTAGGG - Intronic
1166646113 19:44533019-44533041 CTGGCTTAGGAGAAGGTGGGTGG - Intergenic
1167566773 19:50261736-50261758 AGGGCTGAGGAGCAGGTGGATGG + Intronic
1167703507 19:51065103-51065125 GGGCCTGAGGAGAAGGTGAAGGG + Exonic
1167770391 19:51511285-51511307 GAGGCTGAGGGGAGGGTGTGTGG + Intergenic
1168646812 19:58064412-58064434 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
925086326 2:1110465-1110487 GAGGCAGAGGAGAAGGTATTAGG - Intronic
925727418 2:6887041-6887063 AAAGCTGAGGAGGTGGTGTAGGG + Exonic
926079242 2:9970653-9970675 CAGCCTGTGGAGAAGGGGAAGGG + Intronic
926142056 2:10373692-10373714 AAGGCTGAGGAGCAGGTGAGAGG - Intronic
926983331 2:18594774-18594796 AAGGCTGTGGAGAAGGGGAAAGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927112661 2:19875101-19875123 CAGCCTGAGCAGATGCTGTAAGG + Intergenic
927481830 2:23459977-23459999 CAGGTAGAGGAGAAGCTGGAAGG + Intronic
927723153 2:25400067-25400089 GATGCTGATGAGGAGGTGTAGGG + Intronic
931647649 2:64439500-64439522 CAGGCTGAAGAGTATGTGTGTGG + Intergenic
932009422 2:67960391-67960413 CAAACTGAGGAGATGGTGTAGGG + Intergenic
932403279 2:71496636-71496658 CAGGCTGTGGAGGAGGTGTGGGG + Intronic
933998003 2:87684113-87684135 AAGGCGGAGGGGAAGGTGTGAGG - Intergenic
936295847 2:111266753-111266775 AAGGCAGAGGGGAAGGTGTGAGG + Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
937877695 2:126837656-126837678 CAGGCAGAGGAAAAGGTGCCAGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938292619 2:130158176-130158198 CAGGATGAGGAGCAGGTGGGAGG - Intronic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938557108 2:132435296-132435318 TAGGCTGAGGAGAACGAGGAAGG - Intronic
938946433 2:136216560-136216582 CAGGCTGAGGAGATGAGGTGTGG - Intergenic
939015868 2:136903291-136903313 CTAGCTGAGGAAAAGGAGTAAGG + Intronic
939275970 2:139996500-139996522 CACTCTCAGGAGAAGGTGAAAGG - Intergenic
939851018 2:147304911-147304933 AAAGCTGAGGTGAGGGTGTAAGG - Intergenic
944237465 2:197453366-197453388 CAGGCTGACGGGAACGTTTACGG + Intergenic
944467018 2:200012112-200012134 CAGGCCAAAAAGAAGGTGTATGG + Intergenic
946990975 2:225329059-225329081 CAGGCGGAAGAGAAAGAGTAGGG + Intergenic
947869406 2:233424752-233424774 CAGGTTGTGGAGAAGCTGAATGG + Intronic
948023137 2:234753690-234753712 CAGTCGGTGGAGAAGGTGTTTGG - Intergenic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168784441 20:525733-525755 GAGGCTGAGGCCAAGGTGTGAGG + Intronic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1170028909 20:11923484-11923506 CTGGCTGTGTAGAAGGTGTCTGG - Exonic
1170462065 20:16586677-16586699 CAGCCAAAGGAGAAGGTGAAGGG + Intergenic
1170802374 20:19601170-19601192 CAGGTAGAGGAGAAGGCGAATGG - Intronic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171277493 20:23870358-23870380 TAGGTTGAGGATAAGGTGTCAGG + Intergenic
1171406758 20:24916974-24916996 CAGGCTCAGGAGAAGCTGGAAGG - Intergenic
1171431833 20:25087778-25087800 CAGTCTGGGGAGGGGGTGTATGG + Intergenic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172484135 20:35288312-35288334 CAGGCTCAGGGGAGGGTGTCGGG - Intronic
1173526389 20:43736118-43736140 AAGGCTGTGGAGAAAGAGTAAGG + Intergenic
1174094961 20:48081010-48081032 CAGGCTGAGGATGAGGAGAAGGG + Intergenic
1174280525 20:49435685-49435707 AAGGCTGAGGAGCAGATGAAAGG + Intronic
1175564027 20:59958632-59958654 CTGGCTGAGAAGGAGGTGTGTGG + Exonic
1175864081 20:62165325-62165347 CAGGCTGGGGAGATGTTGTCTGG - Intronic
1175921514 20:62452534-62452556 AAGGCTGAGGAGAAGGACTGAGG - Intergenic
1175984801 20:62759299-62759321 CAAGCTGAGGGCAAGGTGTGTGG + Intronic
1176120612 20:63452955-63452977 CAGGCTGAGGGGAGGGTCCAGGG + Intronic
1176309329 21:5141495-5141517 CACGCAGAGGTGAAGGTGGAGGG - Intronic
1176426303 21:6550673-6550695 CTGGCTGAGGAGTATGTGAAGGG + Intergenic
1177512112 21:22101209-22101231 AAGTCTGAGATGAAGGTGTAGGG + Intergenic
1178620687 21:34171767-34171789 CATGCTCAGGAGAAGGAGCAAGG - Intergenic
1179030971 21:37719111-37719133 CAGGAGGAGGAGAGGGTGTGGGG + Intronic
1179701794 21:43158990-43159012 CTGGCTGAGGAGTATGTGAAGGG + Intergenic
1179847733 21:44120538-44120560 CACGCAGAGGTGAAGGTGGAGGG + Intronic
1180917229 22:19497697-19497719 CAGGCTGAGCAGCAGGAGTGGGG - Intronic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1182083534 22:27545591-27545613 CAGGCTCAGGACAAGGTCAAAGG - Intergenic
1182482657 22:30619455-30619477 CAGGGTGAGAAGCAAGTGTAAGG - Intronic
1183292340 22:37010475-37010497 CATGCTCAGGAGCAGGTGAAAGG - Intergenic
1184328023 22:43806355-43806377 GAGGCTGAGGCTAAGGTGCAAGG - Intronic
1184581089 22:45418272-45418294 CAGTCTGCGGGGAAGGTGAATGG + Intronic
1184990746 22:48168144-48168166 CAGGCTGTGCAAAAGGTGTAAGG - Intergenic
1185012232 22:48320765-48320787 CTGGCGGAGGAGATGGTGTCAGG - Intergenic
1185376585 22:50485419-50485441 CTGGGTCAGGAGAAGGTGTCTGG - Exonic
1185380174 22:50504334-50504356 CAGCCTGGGGAGCAGGGGTAAGG - Exonic
1185414685 22:50703666-50703688 AAGGCTGAGGGGATGATGTAGGG - Intergenic
949644992 3:6083326-6083348 CAGGCAGAGGAGGAGGGGTGTGG - Intergenic
949777964 3:7653111-7653133 CAGGCTAAGGAGATGCTGGAGGG - Intronic
950607642 3:14096874-14096896 CAGCCTGAGCAGCAGGTGGATGG + Intergenic
950847916 3:16032696-16032718 CAGGCTTAGGTGAAGATGTGGGG + Intergenic
950901161 3:16499029-16499051 AAGGCAGAGGAAAAGGTCTAAGG + Intronic
950997715 3:17521303-17521325 TAGGCTGAGGAGGAGGTGGAAGG - Intronic
951274312 3:20666461-20666483 CAGGGTGAGTAGAAGGTGAGAGG + Intergenic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
952546277 3:34422972-34422994 ATGGCTGAGAAAAAGGTGTATGG + Intergenic
952806665 3:37362023-37362045 AAGGCTGAGGTAAAGATGTATGG - Intronic
952895348 3:38075093-38075115 CAGCCTGAGGAGGAGGGGAAAGG + Intronic
953123209 3:40066053-40066075 GAGGCTGTGCAGAAGGTGTGGGG - Intronic
953543162 3:43840610-43840632 CTGGCTCAGGAGAAGGGCTAAGG + Intergenic
954061863 3:48074609-48074631 CAGGGTGAGGATAAGGTGGGAGG - Intronic
954634592 3:52064695-52064717 CAGGCAGAGGAGAAGGGGAAAGG + Intergenic
955408747 3:58642461-58642483 CAAGTTGGGGAAAAGGTGTAAGG - Intronic
956502643 3:69903407-69903429 CAGGCTCAGAAGAAGGTCTCAGG - Intronic
956525685 3:70157399-70157421 TACGCTGAGGAGAAGGTAAATGG + Intergenic
958990367 3:100836937-100836959 CAAGCTGAGCAGCAGATGTAAGG + Intronic
961478384 3:127163325-127163347 CAGGCTTTGGAGAGGGTGGAAGG + Intergenic
962329456 3:134464660-134464682 CAGGCTGAGGAGCAAGTGAGGGG + Intergenic
962536099 3:136329829-136329851 CAGGCTGAGCAGAAGGTTGAGGG + Intronic
963129089 3:141841553-141841575 CATGCTGGGGAGAAGGTCAAGGG - Intergenic
963840455 3:150099619-150099641 AAGGCTGAGGAGAGGATGGAAGG + Intergenic
963943207 3:151115957-151115979 GAGGCTGAGGAAAAGGAGAATGG + Intronic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965210281 3:165777776-165777798 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
965879738 3:173374150-173374172 CAGGCTAATAAGAAGGTATATGG + Intergenic
966031387 3:175352292-175352314 GAGGCTGAGGAGAAGAAGGAAGG + Intronic
966732017 3:183159301-183159323 CAGGAGGAAGAGAATGTGTAAGG + Intronic
966923541 3:184629875-184629897 CAGGGGGAGGAGGAGGTGAAAGG + Intronic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
967784048 3:193470772-193470794 CAGGTAGAGGAGGAGGCGTAGGG + Intronic
967826993 3:193884924-193884946 CGGGTGGAGGAGAAGGAGTAGGG + Intergenic
968494830 4:909895-909917 CAGGCTGAGGAGATGCTGCCAGG - Intronic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
971576080 4:28276924-28276946 CATGCTGAGGGGAAAGTTTATGG + Intergenic
972284049 4:37631323-37631345 CAGGGTGAGGAGAAGGTACTTGG - Intronic
972381346 4:38523132-38523154 CAGGCTGAGGAGAAGCCTGATGG - Intergenic
975293045 4:72699910-72699932 CAGGCTGAGGTGGAAGTGGAAGG - Intergenic
976217503 4:82729015-82729037 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
977002146 4:91518315-91518337 CAAGCTGGGGAGGAGGTGTCTGG + Intronic
977569274 4:98612784-98612806 CAGGCTGAGGGGACAGAGTAAGG - Intronic
978224340 4:106316204-106316226 CAGGCTGAGGGGAGGGTAGAGGG - Intronic
978365820 4:107980350-107980372 CTGGCTGAAGAGAAAGTGTTAGG - Intergenic
978901739 4:113958803-113958825 AAGGCTGAGGAGAAAATATAGGG - Intronic
982786004 4:159537627-159537649 CAAGCCCAGAAGAAGGTGTAGGG + Intergenic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
984453896 4:179940492-179940514 CAGGCACAGAAGAAGGTGCAGGG - Intergenic
985496140 5:207516-207538 AAGGCTGAGCAGAAGCTGCAAGG + Intronic
985511834 5:317899-317921 CAGGGTGAGGGGCAGGTGCAAGG - Intronic
985657006 5:1137526-1137548 CAGGTTGAGGAGGAGGGGGAAGG - Intergenic
985923907 5:3000785-3000807 TAGGCGGTGGAGAAGGAGTAGGG + Intergenic
985968191 5:3353598-3353620 CAGGCTGAGTACATGGTTTAAGG - Intergenic
986348066 5:6852892-6852914 CAGGCTGTGCAGAAGGTGCTGGG + Intergenic
986520214 5:8607638-8607660 GAGGCTGATGACAAGGTGGAAGG + Intergenic
988081774 5:26424412-26424434 AAGTCTCAGGAAAAGGTGTATGG - Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
994717344 5:103337434-103337456 GAGGCTGAGGAGAGGTTTTATGG + Intergenic
996325181 5:122265038-122265060 GTGGGGGAGGAGAAGGTGTATGG - Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
1001233575 5:170010457-170010479 CAGGAAGATGAGAAGGAGTAAGG + Intronic
1002411230 5:179078392-179078414 CAGGCTGAGTAGAAGATATGAGG - Intronic
1002972807 6:2041629-2041651 CAGGCTGAGGTGAGGGTCAAGGG + Intronic
1003126987 6:3363431-3363453 CAGGCTGAGGAGAGGCTGTGAGG + Intronic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005965941 6:30726513-30726535 CAGGCTGGGGTGCAGGGGTAGGG - Intergenic
1006975931 6:38101371-38101393 CAGGGAGAAGAAAAGGTGTAAGG + Intronic
1007998468 6:46334169-46334191 CAGGCTAAGGAGATAGTGAAAGG - Intronic
1008228837 6:48958442-48958464 GGGGCTGAGTAGAAGGTGAAGGG - Intergenic
1008252511 6:49257690-49257712 CATGCTGGGGAGAAGGTGAAGGG - Intergenic
1008401886 6:51072690-51072712 CAGACTCAGGAGAAAGGGTAAGG - Intergenic
1008535531 6:52504012-52504034 CAGGCTGGGCAGAACGTGCAGGG + Intronic
1008652211 6:53575116-53575138 CATCTTGAGGAGATGGTGTACGG + Intronic
1009508905 6:64522625-64522647 AAGACTGAGCAGGAGGTGTATGG + Intronic
1011510034 6:88090010-88090032 CAGACTAAGGAGAATGTGCAGGG + Intergenic
1012393438 6:98769300-98769322 CAGGATGAGGTGAAGCTGAAAGG - Intergenic
1014303371 6:119711258-119711280 CAAGCTGAGGAGGAGGGGTTTGG - Intergenic
1015448176 6:133332443-133332465 CAGGCCGAGGAGAAGGCACAGGG - Intronic
1015707467 6:136103813-136103835 CAGGGTGAGGAAAAGGTGTCAGG - Intronic
1016141483 6:140617264-140617286 CAGGCAGAAGAGCATGTGTAGGG - Intergenic
1016466616 6:144331871-144331893 CAGGCTGAGGAGAAAGTGTTTGG + Intronic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1017967146 6:159276563-159276585 CACGCTGAGGAGAATGTGTAAGG + Intergenic
1018355182 6:163007521-163007543 CAAGCTGAGGAGACAGAGTAGGG - Intronic
1019120179 6:169796155-169796177 CAGGCAGAGGAGGATGTGGATGG - Intergenic
1019147144 6:169982790-169982812 CAGGCTGAGAAGCAAGTGGAAGG + Intergenic
1019147652 6:169985328-169985350 CAGGCTGAGAAGCAAGTGGAAGG - Intergenic
1020808055 7:12815034-12815056 TAGGCTAAGGAGAAGGTGCATGG + Intergenic
1021146345 7:17093805-17093827 CAGCTTGGGGAGAAGGGGTAGGG - Intergenic
1021354927 7:19642533-19642555 CAGGCATAGGAGAAGATGCAGGG - Intergenic
1021645005 7:22781438-22781460 CAGGCTGAGGAGAAATTATTAGG - Intergenic
1021690203 7:23223599-23223621 CAGACAGAGGAGGAGGTGAAGGG - Intergenic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1022342955 7:29486020-29486042 CAGGCTGGGCAGGAGGTGGAAGG - Intronic
1023173422 7:37412336-37412358 CAGGCTGAGGTGGTGGTGAAGGG - Intronic
1023754893 7:43407406-43407428 CAGGCTGGGGTGAAGGAGTGAGG - Intronic
1023990640 7:45126347-45126369 CAGGCTGAAGAGACAGTGTATGG + Intergenic
1024964151 7:55006622-55006644 CAGGCTGAGGAGGAGGTCGCTGG + Intergenic
1026176324 7:68000981-68001003 GAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1026631200 7:72039700-72039722 CAGGCTTAGAAGGAGGAGTAAGG + Intronic
1028249357 7:88522781-88522803 CAGGCTGTGGAGAAGGAGCAGGG + Intergenic
1029309641 7:99650730-99650752 GAGGCAGAGGAGAAGGTGGACGG - Intronic
1029342362 7:99955555-99955577 GAGGCTGAGGACAGGATGTAAGG - Intergenic
1030955126 7:115843299-115843321 GAGGCTGAGGGGAAGGTAAAGGG + Intergenic
1031685755 7:124730685-124730707 CAGCCTGAGGAGGAGGGGAAAGG - Intergenic
1031834542 7:126667604-126667626 AAAGCTGAGGAGAAGGTGGAAGG + Intronic
1032529329 7:132607314-132607336 CAGGAGGGGGAGAAGGTGGAAGG - Intronic
1032774666 7:135099611-135099633 AAGACAGAGGAAAAGGTGTAAGG - Intronic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034923801 7:155104459-155104481 CAGGCTGAGTGGAATGTGAAGGG + Intergenic
1035038406 7:155910218-155910240 CAGGCAGAGGAGGAGGAGCAAGG - Intergenic
1035438350 7:158876144-158876166 CAGTCTTAGGAGAAGGTGAAGGG + Intronic
1035553339 8:545563-545585 AAGGCTGAGGGGAAGGTGGAGGG + Intronic
1035599921 8:891364-891386 CAGGCTGTGGAGAATGTGAGTGG + Intergenic
1036559224 8:9887516-9887538 CCACCTCAGGAGAAGGTGTAAGG - Intergenic
1038493522 8:27986177-27986199 CAGGCGGAGGAGAAGGCCTGGGG - Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1039184306 8:34899702-34899724 AAGGTTGAGGAGAAGGTGGCTGG - Intergenic
1041201305 8:55453605-55453627 CAGGCTGAGGCCAAGATGCAAGG - Intronic
1041201649 8:55455289-55455311 CTGGCTGAGAAGATGGTGTCTGG - Intronic
1044808296 8:96031224-96031246 CTGGCTGGAGAGAAGGGGTAGGG - Intergenic
1046364354 8:113206611-113206633 AAGGCTGAGGAAAAGGTTGAAGG - Intronic
1047308875 8:123675999-123676021 CAGGCTCAGCACAAGGTTTAGGG + Intergenic
1047446345 8:124923651-124923673 CAGGAGGAGGAGCAGGTCTAGGG - Intergenic
1048225567 8:132581989-132582011 CATGCTGAGGAGAAAGTGAATGG - Intronic
1048462384 8:134632148-134632170 TAGGCTGAGGAGAAAGAGGAGGG - Intronic
1049339654 8:142105362-142105384 GGGGCTGAGGAGCAGGGGTAGGG - Intergenic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1050994819 9:12203207-12203229 GAGGGAGAGGAGAAGGTGTTGGG + Intergenic
1051603292 9:18895683-18895705 CAGTCTGAGGTGAAAGCGTAAGG - Intronic
1052914237 9:33912001-33912023 TTGGCTGGGGAGAAGGTGTTGGG - Exonic
1053196465 9:36122987-36123009 CAAGCTGAGGGGAAGGAGGAGGG - Exonic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056600410 9:88042602-88042624 CTGCCTGAGGGGAAGGTTTAGGG + Intergenic
1056656352 9:88512661-88512683 AGGGTTGAGGAGAAGGTGTAGGG + Intergenic
1056778733 9:89533508-89533530 CAGGCTGAGGACTTGGTGCAGGG - Intergenic
1057113914 9:92502063-92502085 GATGATGAGGAGAAGGAGTATGG + Intronic
1058850995 9:109012715-109012737 CAGGTTCAGGGGAAGGGGTAGGG + Intronic
1058956141 9:109950502-109950524 CAGACAGAGGAGCAGGTGTAGGG - Intronic
1059249902 9:112879292-112879314 CAGCCTGAGGGGAATGTGGAAGG - Exonic
1059662061 9:116411531-116411553 CAGCCTGAGGAGAAGGAGTTTGG - Intergenic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059783119 9:117550914-117550936 CAAGGTGAGGAGAAGGTAAATGG + Intergenic
1060168751 9:121443194-121443216 CAGGCAGAGGAGTAGGTGGAAGG - Intergenic
1060205771 9:121682040-121682062 CAGGCAGAGGACAAGGTGTTTGG + Intronic
1060290882 9:122301326-122301348 CAGGCTGAGGTAAATGTGGAGGG + Intronic
1060624914 9:125102902-125102924 AAGGGAGAGGAGAAGGTGTTTGG - Intronic
1061450032 9:130662822-130662844 CGCGCTGAGGAGAAGGTCTAGGG + Intergenic
1061507664 9:131040691-131040713 CAGGCTGGGGAGAGGGGGCAGGG - Intronic
1061664095 9:132150287-132150309 CAGGCTGTTGAGAAGGTGGCAGG - Intergenic
1186156645 X:6733043-6733065 CAGGGTGATGAGAAGGGGCATGG + Intergenic
1186518053 X:10181516-10181538 AAGGCAGAGGAGAAGGTTCAAGG + Intronic
1186581608 X:10825651-10825673 CAGGTTGAGGGGAGGGGGTAAGG + Intronic
1187279916 X:17850353-17850375 ATGGCTGAGGAGAGGGTGAAGGG + Intronic
1187612483 X:20957401-20957423 GAAGCTAAGGAGAAAGTGTAAGG - Intergenic
1188923964 X:36016269-36016291 CAGGATGAGGGGATGGTATATGG - Intergenic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1189693233 X:43638292-43638314 CAGGCTGAGGAGAGTGTGATAGG + Intergenic
1190076711 X:47322366-47322388 CAGCCTGAGGAGAGTGTGTAGGG - Intergenic
1190113601 X:47611110-47611132 CAGGCTGAGGAGCCCATGTAGGG - Intronic
1190385508 X:49879555-49879577 GAGGCGGAGGCGAAGGTGGAGGG + Intergenic
1190777236 X:53562674-53562696 CTGGCTGAGGATAAAGTGGATGG + Intronic
1191842875 X:65525469-65525491 CAGGGAGAAGAGAAGGGGTAGGG - Intronic
1192936002 X:75859054-75859076 CAGGCTAAGGGGAAGGGGAATGG + Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193867787 X:86757714-86757736 CAGGAGGAGGAGAAAGTGAAGGG - Intronic
1193908760 X:87277024-87277046 CAGGGTGGGGAGAAGGCGAAGGG - Intergenic
1196586077 X:117429499-117429521 CATACTAAGGAGATGGTGTATGG + Intergenic
1197822798 X:130558571-130558593 CAGTTTCAGTAGAAGGTGTATGG - Intergenic
1198028367 X:132731025-132731047 TAGGATGAGGAGAGGGTGTTGGG - Intronic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199880876 X:151973741-151973763 CAGGGCGAGGAGAAGGTGTGAGG + Intronic
1200132750 X:153860104-153860126 GGGGCTGAGGGGAAGGTGTGAGG + Intergenic