ID: 907071078

View in Genome Browser
Species Human (GRCh38)
Location 1:51535405-51535427
Sequence CTTTAAAGACAGAAGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907071078_907071079 8 Left 907071078 1:51535405-51535427 CCTAGTTTCTTCTGTCTTTAAAG No data
Right 907071079 1:51535436-51535458 TATGACCCTGACTCTATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907071078 Original CRISPR CTTTAAAGACAGAAGAAACT AGG (reversed) Intergenic
No off target data available for this crispr