ID: 907074456

View in Genome Browser
Species Human (GRCh38)
Location 1:51565781-51565803
Sequence GCCTACACCTCAACTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907074453_907074456 -2 Left 907074453 1:51565760-51565782 CCTTCTCTTTCTCAGACCACTGC No data
Right 907074456 1:51565781-51565803 GCCTACACCTCAACTCAGGCTGG No data
907074452_907074456 27 Left 907074452 1:51565731-51565753 CCTAGGTTAACTCACTCACTCAA No data
Right 907074456 1:51565781-51565803 GCCTACACCTCAACTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907074456 Original CRISPR GCCTACACCTCAACTCAGGC TGG Intergenic
No off target data available for this crispr