ID: 907075263

View in Genome Browser
Species Human (GRCh38)
Location 1:51572478-51572500
Sequence CCGTCACACTAAGCTCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907075259_907075263 1 Left 907075259 1:51572454-51572476 CCCTAGGTCTGTCTGCTCCTCTC No data
Right 907075263 1:51572478-51572500 CCGTCACACTAAGCTCCTCTAGG No data
907075260_907075263 0 Left 907075260 1:51572455-51572477 CCTAGGTCTGTCTGCTCCTCTCT No data
Right 907075263 1:51572478-51572500 CCGTCACACTAAGCTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907075263 Original CRISPR CCGTCACACTAAGCTCCTCT AGG Intergenic