ID: 907080186

View in Genome Browser
Species Human (GRCh38)
Location 1:51614802-51614824
Sequence GTTACTCACATTTTAAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 451}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907080184_907080186 -2 Left 907080184 1:51614781-51614803 CCTTTGTAGACAGCTACTATTGT 0: 1
1: 0
2: 0
3: 14
4: 110
Right 907080186 1:51614802-51614824 GTTACTCACATTTTAAAGAAGGG 0: 1
1: 0
2: 2
3: 49
4: 451
907080183_907080186 9 Left 907080183 1:51614770-51614792 CCTTGAAACAACCTTTGTAGACA 0: 1
1: 1
2: 0
3: 13
4: 182
Right 907080186 1:51614802-51614824 GTTACTCACATTTTAAAGAAGGG 0: 1
1: 0
2: 2
3: 49
4: 451
907080181_907080186 29 Left 907080181 1:51614750-51614772 CCCATAGGAGCTCACTTAATCCT 0: 1
1: 0
2: 3
3: 25
4: 221
Right 907080186 1:51614802-51614824 GTTACTCACATTTTAAAGAAGGG 0: 1
1: 0
2: 2
3: 49
4: 451
907080182_907080186 28 Left 907080182 1:51614751-51614773 CCATAGGAGCTCACTTAATCCTT 0: 1
1: 0
2: 0
3: 16
4: 209
Right 907080186 1:51614802-51614824 GTTACTCACATTTTAAAGAAGGG 0: 1
1: 0
2: 2
3: 49
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907080186 Original CRISPR GTTACTCACATTTTAAAGAA GGG Intronic
900827109 1:4935648-4935670 GTTACTCCCATTTTATAGGGAGG + Intergenic
900839132 1:5033023-5033045 GATACCCACATTTTTCAGAATGG - Intergenic
901720354 1:11192444-11192466 GCCATTCACAGTTTAAAGAAAGG + Intronic
902590013 1:17467048-17467070 GTTATTCCCATTTTACAGAAGGG - Intergenic
902813709 1:18904070-18904092 ATTACACACATTTTACTGAAGGG - Intronic
902983523 1:20141884-20141906 GTTACTCCCATTTTACAGATGGG + Intronic
903705331 1:25281360-25281382 TTTCCTCTCATTTTACAGAAGGG - Intronic
903721895 1:25411970-25411992 TTTCCTCTCATTTTACAGAAGGG + Intronic
904515918 1:31054971-31054993 GTTTCTCACTTTTCAAAAAAGGG + Intronic
905715448 1:40145558-40145580 GTTGCTCCCATTTTGATGAAGGG - Intergenic
905805450 1:40873798-40873820 GTTTCTCCCATTTTACAGAAAGG + Intergenic
907080186 1:51614802-51614824 GTTACTCACATTTTAAAGAAGGG + Intronic
907289759 1:53406202-53406224 GGTCCTCACTTTTTAAAAAAGGG - Intergenic
907344525 1:53763748-53763770 GTTAAGCTCATTCTAAAGAATGG + Intergenic
907429186 1:54401852-54401874 GTTACTCACATAATCATGAAAGG + Exonic
908612918 1:65883043-65883065 GTTAGTCATATTTTAAAGGTGGG - Intronic
908960281 1:69689236-69689258 GTTAGTCAGATTTTACAGAAAGG + Intronic
909272399 1:73640323-73640345 GTTACTTACTTTTTAAATTAAGG + Intergenic
909516837 1:76519473-76519495 ACTACTCACATTTCAAAGAAAGG - Intronic
909539396 1:76773919-76773941 GTTATTTTCATTTTACAGAAGGG + Intergenic
910363854 1:86442867-86442889 GTTATCCACATTTTAGAGATGGG - Intronic
910592477 1:88941187-88941209 TTGACTGAAATTTTAAAGAACGG - Intronic
911002953 1:93185715-93185737 GTTACCCACCTATTAAAGATGGG + Intronic
912157110 1:106934444-106934466 GTTCCTACCATGTTAAAGAAAGG - Intergenic
912160472 1:106978145-106978167 CTTAATCAAATTTTTAAGAATGG + Intergenic
912681429 1:111731660-111731682 GTTATTCCCATTTTAAAGAGTGG - Intronic
914736887 1:150426417-150426439 ATTATTCACATTTTACAGATGGG - Intronic
914897143 1:151686565-151686587 GATAGTCAGATTTTGAAGAAAGG + Intronic
916849527 1:168689440-168689462 GTTACTGCCATTTTATAGATAGG - Intergenic
916957387 1:169853334-169853356 CTTACTCTTATGTTAAAGAATGG + Exonic
917048311 1:170888645-170888667 GTCACTCACATTTTAAGTGAAGG + Intergenic
917745374 1:178001446-178001468 TTTACTCATCTGTTAAAGAAAGG - Intergenic
918311821 1:183290521-183290543 GTTATTCCCATTTTACAGATGGG - Intronic
919504335 1:198379186-198379208 ATTATTCACATTTTACAGAAGGG + Intergenic
919699732 1:200619874-200619896 GGTATTAACGTTTTAAAGAAAGG + Intronic
919954615 1:202400765-202400787 GTTATTCCCATTTTATAGATGGG + Intronic
920375071 1:205503979-205504001 GGCACTCTCATTTTACAGAAGGG - Intergenic
922145997 1:222945109-222945131 GTTACACTCTTTTTAAAGAGAGG + Intronic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
924025595 1:239829782-239829804 GTTATTCCCATTTTAGAGATAGG - Intronic
924154559 1:241162766-241162788 ATTATTCCCATTTTACAGAAGGG + Intronic
1062890895 10:1058935-1058957 GTTAATCACATGCAAAAGAATGG - Intronic
1063051149 10:2449404-2449426 TATACTGACATTTTAAAGAGAGG - Intergenic
1065402426 10:25320625-25320647 GTGACTCACATTTTAGATTAAGG - Intronic
1065495586 10:26324177-26324199 GATCATCACATTTGAAAGAAAGG + Intergenic
1066250418 10:33627483-33627505 TGAAATCACATTTTAAAGAACGG + Intergenic
1068019454 10:51562701-51562723 GTTACTTACATTTTCAAAATAGG - Intronic
1069927699 10:71862510-71862532 ATTACTCCCATTTTACAGATGGG + Intergenic
1069998677 10:72359744-72359766 GTGACTCAGATTTGTAAGAAAGG - Intergenic
1070282106 10:75057513-75057535 ATTACTCCCATTATAAAGATAGG - Intronic
1070463532 10:76693738-76693760 GTTACCCACATTTTACAAATGGG + Intergenic
1070524681 10:77285571-77285593 GAAAAACACATTTTAAAGAAGGG - Intronic
1070530929 10:77336824-77336846 GTTAGTCCCATTTTACAGATGGG - Intronic
1071146079 10:82573977-82573999 GTTCCTCAAATGTTAAAAAATGG + Intronic
1071337796 10:84615507-84615529 GTTACTCCCATTTTACAGCAGGG + Intergenic
1071798501 10:89031471-89031493 TTTACTCACATTTTAATCAAAGG - Intergenic
1071955167 10:90749713-90749735 ATTACTCCCATTTTGCAGAAAGG + Intronic
1071970682 10:90903263-90903285 GGTACCAACCTTTTAAAGAAGGG - Intronic
1072197064 10:93125361-93125383 GCTATTCTCATTTTAAAGATGGG + Intergenic
1072861603 10:99011296-99011318 GTATTTCACATTTTACAGAAAGG + Intronic
1073194336 10:101676163-101676185 CTTTTTCACATTTTAAAGAAGGG - Intronic
1073859192 10:107717847-107717869 GTTGCTCACAATATAGAGAATGG - Intergenic
1074062134 10:109976278-109976300 GTTTCTTACATTTTAAAACAAGG + Intergenic
1074278684 10:112029521-112029543 GATGATCACATTTCAAAGAATGG + Intergenic
1074494454 10:113967700-113967722 GTTATTCCCATTTCAAAGATGGG + Intergenic
1074798250 10:116971526-116971548 GTTCCTCTCATTTTCTAGAATGG + Intronic
1074962302 10:118458041-118458063 GTTAGTCCCATTTTACAGATAGG - Intergenic
1075373646 10:121959189-121959211 GTTACACACAGTTCTAAGAATGG + Intronic
1076080073 10:127571632-127571654 GTTAGTCACTTCTTAAAGCAAGG - Intergenic
1076112108 10:127868235-127868257 GTTGATCACCTTTTGAAGAAAGG + Intergenic
1076652403 10:131998966-131998988 GTCACCCTCATTTTAAAGATGGG - Intergenic
1076947705 10:133663090-133663112 GAAACTAATATTTTAAAGAATGG - Intergenic
1078382310 11:10855298-10855320 GTTATACATATTTTTAAGAAAGG + Intronic
1078984052 11:16573004-16573026 TCTACTGAAATTTTAAAGAATGG - Intronic
1079302032 11:19286616-19286638 GTTACACCCATTTTACAGAGAGG + Intergenic
1079502981 11:21123102-21123124 GTTACTCTTATTTTTAAAAAGGG - Intronic
1079995386 11:27290149-27290171 CTCAAACACATTTTAAAGAATGG + Intergenic
1080990837 11:37532866-37532888 GTTAATCTGATTTTAAAGCAAGG + Intergenic
1081213522 11:40365422-40365444 ATTACTCATATGTAAAAGAAAGG + Intronic
1081921559 11:46782467-46782489 GTTACTCAAATAACAAAGAACGG - Intronic
1082257825 11:50051934-50051956 TTTACTTTCATTTTAAAGACAGG + Intergenic
1082287373 11:50332336-50332358 ATTCCTCCCATTTTAAAGATGGG - Intergenic
1083786613 11:64952545-64952567 GTTATTCCCATTTTACAGACGGG + Intronic
1084616186 11:70237487-70237509 TTTACCACCATTTTAAAGAAGGG - Intergenic
1085749958 11:79153196-79153218 ATTACTGACATTTTATAAAAGGG - Intronic
1085809378 11:79666843-79666865 GTTTCTCATATTTAAAATAAAGG + Intergenic
1085967394 11:81544283-81544305 TTTAATTACTTTTTAAAGAATGG + Intergenic
1086258902 11:84914162-84914184 CTAACTTTCATTTTAAAGAAAGG + Intronic
1086923316 11:92612534-92612556 ATTCCCCACATTTTAAAAAATGG - Intronic
1087157086 11:94915750-94915772 ATTATTCACATTTTATTGAAAGG + Intergenic
1087650107 11:100856239-100856261 CTAATTCACATTTTAAATAAGGG + Intronic
1087654135 11:100902329-100902351 ATGACTCCCATCTTAAAGAATGG - Intronic
1087896449 11:103591474-103591496 GTTACTCCCATTTTAAATATGGG + Intergenic
1088274556 11:108071499-108071521 ATGACTGACCTTTTAAAGAAAGG + Intronic
1088489565 11:110373615-110373637 ATGACTCACATGTAAAAGAAAGG - Intergenic
1089229600 11:116960689-116960711 GTTGCCCACATTTTACAGATAGG - Intronic
1089594771 11:119571242-119571264 GATACTCATATTATAAACAAAGG - Intergenic
1090782122 11:130016605-130016627 CTTAATCATATTTTAAACAAAGG - Intergenic
1090809706 11:130226138-130226160 GTTACTGTCATTCTAAAGACCGG + Intergenic
1091736002 12:2922460-2922482 GTTACCCACAATGAAAAGAAAGG - Intronic
1092376647 12:7961214-7961236 GTTGCACACATTTTAAAAACAGG - Intergenic
1093705519 12:22270800-22270822 TTTACACAAATTTTAAAGATAGG + Intronic
1094750449 12:33400136-33400158 GCTAATAACATTTTAAAGAGTGG - Intronic
1095402055 12:41825945-41825967 GTTTATTACATTTAAAAGAATGG - Intergenic
1095592632 12:43920761-43920783 GTAATCCACATTTTAAAGGATGG - Intronic
1098334838 12:69392699-69392721 GTTATTCATATTTTACAGATAGG + Intergenic
1098392288 12:69982140-69982162 ATTAGTCACATTTTGCAGAAGGG - Intergenic
1098418881 12:70269707-70269729 GTTACCTACATTTTAAATTAAGG + Intronic
1098619302 12:72573240-72573262 GTTATTTTAATTTTAAAGAATGG + Intronic
1099059272 12:77885855-77885877 GTTACTACCATTATCAAGAAAGG - Intronic
1099767630 12:87008788-87008810 GTTACTAAAAGTCTAAAGAAGGG + Intergenic
1099866423 12:88288067-88288089 GATAGTGATATTTTAAAGAAAGG - Intergenic
1100428845 12:94512346-94512368 GTTTCCCACATTTAAGAGAAAGG - Intergenic
1100507069 12:95232713-95232735 CATACTGACATTTTAAATAAAGG + Intronic
1100639142 12:96464644-96464666 ATTATTCCCATTTTAAAGATTGG + Intergenic
1100800129 12:98222290-98222312 ATTACTCACATTATACAGTATGG - Intergenic
1100852134 12:98723493-98723515 GTTAGTCACATTTAAAGTAAAGG + Intronic
1100953933 12:99885231-99885253 CTAACTCACATTTTAAATCAGGG + Intronic
1101019295 12:100536286-100536308 GTTATTCATATTTTATAGATAGG + Intronic
1101293514 12:103396496-103396518 GTTTCTAACATTTTAATGAATGG + Intronic
1101799168 12:108005706-108005728 ACCACTCACATTTCAAAGAAGGG + Intergenic
1102429503 12:112870991-112871013 GTTATTCGCATTTTACAGAATGG + Intronic
1103249542 12:119487696-119487718 ATTATGCACATTTTAGAGAAGGG - Intronic
1103319968 12:120086792-120086814 ATTAATCACATTTTAAAAATAGG - Intronic
1104392987 12:128406946-128406968 GATGCTCACTTTTTATAGAAGGG - Intronic
1105308488 13:19185765-19185787 ATTACCCACATTTTAACAAATGG - Intronic
1105362127 13:19729552-19729574 GTTACTAAAATATTAAAGACAGG + Intronic
1106086841 13:26550492-26550514 TTTACTCTCATTTTATATAAGGG + Intergenic
1106647615 13:31653507-31653529 CTTTCTCACATTTTAGGGAAAGG + Intergenic
1107050326 13:36040650-36040672 GCAACTCACATTTTAAGGAGTGG + Intronic
1107605996 13:42057726-42057748 GGAACTCACATTTTAATGCAAGG + Intronic
1108037829 13:46310200-46310222 GTCACTCAGAATTTGAAGAAAGG + Intergenic
1108179996 13:47831184-47831206 TTTACTCACTTCATAAAGAAAGG - Intergenic
1108246067 13:48515540-48515562 GCTACTCACATTTTTAGAAATGG - Intronic
1109177191 13:59171019-59171041 GTTAATGAAATTTTAGAGAAGGG - Intergenic
1109261634 13:60151298-60151320 ATTACTTCCATTTTATAGAAGGG + Intronic
1111159615 13:84377438-84377460 GTTATTCACATTTTAGAAAGTGG + Intergenic
1111571497 13:90093191-90093213 TTTACTCACATTTCATATAAAGG - Intergenic
1112066446 13:95798168-95798190 ATTATTCAGATTTTAAAGATGGG - Intergenic
1112199062 13:97257819-97257841 GTTCTTCACATTTTATGGAAGGG - Intronic
1112744001 13:102507220-102507242 ATTATTCACATTTTATAGTAGGG - Intergenic
1112784053 13:102932161-102932183 TTAACTTGCATTTTAAAGAAAGG + Intergenic
1112804705 13:103151495-103151517 GTTACTCACATTTACTAGGAAGG + Intergenic
1113578289 13:111410113-111410135 ATTGCTCAAATTTTAATGAAAGG + Intergenic
1115435997 14:33374355-33374377 GTTAATCACACTTTGAAGATTGG + Intronic
1115437390 14:33390719-33390741 TTTCCCCACATTTTAAAGATGGG - Intronic
1115837537 14:37425586-37425608 ATTACTCTCATTTTAAAGAAAGG - Intronic
1115931830 14:38505873-38505895 GGGACTTACATTTTAAGGAAAGG + Intergenic
1116620420 14:47195708-47195730 GTAACTGACAATTGAAAGAAAGG + Intronic
1116874852 14:50100820-50100842 GATATTCTCATTTTACAGAAAGG + Intergenic
1117017186 14:51530103-51530125 GTTCATTACATTCTAAAGAAAGG + Intronic
1118109772 14:62704861-62704883 TTTACTCAGATTTGAATGAAGGG - Exonic
1118698013 14:68403944-68403966 ATTATTCACATTTTACAGATGGG + Intronic
1119319465 14:73721092-73721114 GTTATTCCCATTTTATAGATGGG - Intronic
1119578328 14:75750032-75750054 TTCACTCACATTTTAATGACAGG + Intronic
1119680922 14:76591649-76591671 GTTTCTTTTATTTTAAAGAAAGG + Intergenic
1119734181 14:76970904-76970926 GTTCCACACATTTTAGATAAGGG + Intergenic
1119921110 14:78446952-78446974 TTTACTCGCCATTTAAAGAATGG + Intronic
1120062647 14:80002219-80002241 GTGATTCACAATTTAAAAAATGG - Intergenic
1120098083 14:80411806-80411828 GTTACTCTCACTTTTATGAAAGG + Intergenic
1120162836 14:81163865-81163887 CTTCCTCATATTTGAAAGAAAGG - Intergenic
1120595352 14:86427543-86427565 TTTAATCATATTTTATAGAAAGG + Intergenic
1122428046 14:101623116-101623138 ATTACTCCCATTTTACAGATGGG + Intergenic
1124020226 15:25914559-25914581 GTTACTCACATGAGAAAGAATGG - Intergenic
1124553670 15:30706774-30706796 ATTACTCTTATTTTTAAGAAGGG + Intronic
1124677578 15:31698900-31698922 ATTACTCTTATTTTTAAGAAGGG - Intronic
1124846330 15:33294741-33294763 GTTATTCCCATTTTACAGATAGG + Intergenic
1124877443 15:33608496-33608518 ACTACTCACATTTTAAAGTGAGG + Intronic
1127732022 15:61810565-61810587 GTTACACAGATTTAAAAGCAGGG - Intergenic
1127919400 15:63481461-63481483 GTTACTCCCTTTTTACGGAAGGG + Intergenic
1128939935 15:71779722-71779744 GTCATTCTCCTTTTAAAGAATGG - Exonic
1129447993 15:75632143-75632165 GTTAACCACATTTTACAGAGAGG - Intergenic
1129517889 15:76167921-76167943 GTGATTCCCATTTTACAGAAAGG - Intronic
1129800255 15:78408493-78408515 AAGACACACATTTTAAAGAAGGG - Intergenic
1129801145 15:78415407-78415429 TTATCTCACTTTTTAAAGAAGGG - Intergenic
1131226090 15:90625468-90625490 GTGCCTCACATTTTATAGAGTGG + Intronic
1131457877 15:92597383-92597405 GCTACTCATACTTGAAAGAAAGG - Intergenic
1134443989 16:14316901-14316923 TTTATTCTCAGTTTAAAGAATGG - Intergenic
1135231201 16:20709688-20709710 GTTATTCACTTTCTCAAGAAGGG + Intronic
1137327357 16:47455233-47455255 TCTACTCACATTTTCAAGTAAGG - Intronic
1138610551 16:58120232-58120254 GTTTGTCCCGTTTTAAAGAATGG - Intronic
1140200841 16:72893530-72893552 GGTACTCACACTTTAAAAAATGG + Intronic
1143580872 17:7825008-7825030 GTTACCCCCATTTTAAAGATAGG + Intronic
1143695668 17:8614832-8614854 GTGACACTCATTTTAAAAAAGGG + Intronic
1144485553 17:15661389-15661411 GTTTCTTACATTTTAGAGAGAGG - Intronic
1145035638 17:19538690-19538712 CTTCCTCACATGTAAAAGAAGGG + Intronic
1145749151 17:27342795-27342817 GTTATCCACATTTTATAGATGGG + Intergenic
1149450970 17:56749785-56749807 GTTACCCCCATTTTACAGATAGG - Intergenic
1151028513 17:70707125-70707147 TTTGCCCAAATTTTAAAGAAAGG - Intergenic
1151633290 17:75326077-75326099 GTTACTCACATTTTGAAGGCTGG - Intronic
1152731773 17:81975894-81975916 TTTAATAACTTTTTAAAGAAGGG + Intergenic
1152893102 17:82893852-82893874 TTTACTCACGTGTTAAAGAGGGG + Intronic
1153412120 18:4804917-4804939 GATATACATATTTTAAAGAAGGG + Intergenic
1154345259 18:13538414-13538436 TTTTCACCCATTTTAAAGAATGG + Intronic
1156138686 18:34078315-34078337 ATTACTTAAATTTAAAAGAAGGG - Intronic
1156279057 18:35615370-35615392 CTTAGCCACATTTTAAAAAATGG + Intronic
1156649433 18:39207093-39207115 ATTCCTTCCATTTTAAAGAAAGG - Intergenic
1157989632 18:52479063-52479085 GTTAGTTACATTTTTTAGAATGG + Intronic
1158805086 18:60961764-60961786 GATGCTCACATTTTACAGATGGG - Intergenic
1158846207 18:61445522-61445544 ATTATTCTCATTTTAAAGATAGG + Intronic
1159611623 18:70532040-70532062 GTTCCTCAAAATTTAAAAAAAGG - Intergenic
1160071276 18:75630128-75630150 GTTGCTGACATTTTAAACATTGG - Intergenic
1160405345 18:78642117-78642139 GTTAATCACAATTAAAAAAAGGG - Intergenic
1161940088 19:7396824-7396846 CTTATTCCCATTTTAAAGATGGG - Intronic
1162061787 19:8100666-8100688 TTTACTATCATTTTAAAAAATGG + Intronic
1162846834 19:13399273-13399295 GTGATTCACATTTTAATTAATGG - Intronic
1162948210 19:14056218-14056240 GTTATTCCCATTTTAGAGATGGG + Intronic
1163221784 19:15927067-15927089 GTTATTCCCATTTTACAGATAGG + Intronic
1166585348 19:43941761-43941783 GTTACTAATATTATAAATAATGG + Intergenic
925551996 2:5086580-5086602 GTAACACACACTGTAAAGAATGG + Intergenic
925895174 2:8465864-8465886 GTTACTGCCATTTGTAAGAAAGG + Intergenic
925895945 2:8472267-8472289 ATCACCCACATTTTACAGAAAGG - Intergenic
927566310 2:24116361-24116383 TGTACTCACGTTTTAAAGATGGG + Intronic
929055235 2:37870876-37870898 GTTACTTACTGTTTAAAAAAAGG - Intergenic
929856151 2:45640083-45640105 ATTATTCCCATTTTAAAGACGGG - Intergenic
930144961 2:47992437-47992459 CTTATTACCATTTTAAAGAAGGG - Intergenic
930405079 2:50944252-50944274 GTTACACAAATTATAAAGAATGG + Intronic
931596869 2:63956668-63956690 GTTACCCACACTTTACAGATAGG - Intronic
933201138 2:79450241-79450263 GATACTAAAATGTTAAAGAAGGG + Intronic
933304733 2:80583138-80583160 GTTATTCGCATTTTAGAGAGAGG - Intronic
933384053 2:81587641-81587663 GTTTCTAACATTTTAAAATATGG + Intergenic
935396537 2:102615813-102615835 GCAATGCACATTTTAAAGAAAGG + Intergenic
935556115 2:104511301-104511323 GTTACTGAAATTTTTAAGAAGGG + Intergenic
936434770 2:112494875-112494897 GTTACACACAGTAAAAAGAATGG - Intronic
937556943 2:123169737-123169759 GTTACTAACATTTAAAGAAAAGG + Intergenic
937940074 2:127278471-127278493 GTTGTTCCCATTTTATAGAAGGG - Intronic
938606854 2:132903041-132903063 TTTACTCTCATTTTATAGATTGG - Intronic
939395344 2:141622192-141622214 ATTACTCTCATTTTATAGCAAGG + Intronic
939551583 2:143622416-143622438 TTTACTGTCACTTTAAAGAACGG - Intronic
939891230 2:147738690-147738712 ATTACTCTCATTTTACAGAGAGG + Intergenic
939897969 2:147815698-147815720 ATATATCACATTTTAAAGAAGGG + Intergenic
940083585 2:149832597-149832619 ATTACTCACACTTTAAAAATTGG - Intergenic
940488049 2:154321807-154321829 CTTAATGACATTTTAAATAATGG - Intronic
941180898 2:162258185-162258207 ATTATTCACATTTTACAGACTGG + Intergenic
941574918 2:167217562-167217584 ATTACCCACATTTTAAAATAAGG - Intronic
941791028 2:169552162-169552184 GTTACTAACATTTGAAAGTTTGG - Intronic
942467625 2:176225129-176225151 GCTGCACACATTTTACAGAACGG - Intergenic
943042684 2:182821879-182821901 GATAAAAACATTTTAAAGAAAGG - Intergenic
943540454 2:189207390-189207412 GTAACTTACATTTAATAGAATGG - Intergenic
944668843 2:201978724-201978746 GTTATTCTCATTTTGTAGAAGGG - Intergenic
944690507 2:202154368-202154390 GTTACTCCCATTATACAGACAGG - Intronic
945476949 2:210294958-210294980 ATTACTTAAAATTTAAAGAAAGG - Intronic
945744160 2:213700541-213700563 GTTACTTACATCTTAATGAAGGG + Intronic
946545164 2:220732638-220732660 GTGAGTTTCATTTTAAAGAAAGG - Intergenic
946850357 2:223900354-223900376 GTAGCAAACATTTTAAAGAAAGG + Intronic
946868933 2:224068555-224068577 CCCACTCACATTTTAAAGGATGG - Intergenic
947173817 2:227339590-227339612 GTTGCTCATATTTGGAAGAATGG - Intronic
947566597 2:231198242-231198264 GTTATTCCCATCTTAAAGGAGGG - Intergenic
947921122 2:233875289-233875311 ATTATCCACATTTTACAGAATGG + Intergenic
1169648324 20:7839537-7839559 GTTGCTCAAATTCAAAAGAATGG - Intergenic
1169866838 20:10210319-10210341 GTTACTCTTCTTTAAAAGAATGG - Intergenic
1172829313 20:37819602-37819624 CTTACTTACATTTTAAAAAGGGG - Intronic
1173439831 20:43066392-43066414 GTTAATCTCATTTTAAAAGACGG - Intronic
1173660526 20:44730118-44730140 ATTATCCCCATTTTAAAGAAGGG - Intergenic
1173723933 20:45283749-45283771 GCTACTCCCATTTTGCAGAAGGG - Intergenic
1173826494 20:46051160-46051182 ATTACTCCCATTTTATAGATGGG - Intronic
1173861919 20:46289373-46289395 GGCACTCACATTATAGAGAAAGG - Intronic
1174266545 20:49336096-49336118 GTTACTCTCATTTTATAGATGGG + Intergenic
1174338476 20:49881495-49881517 TTTAATCACTTTTTAAAGGACGG + Intronic
1174869628 20:54171217-54171239 GTTACTCCCATTTTGTAGATGGG + Intronic
1175173505 20:57095444-57095466 GTTACTCCCATTTTACAGCTGGG - Intergenic
1175629371 20:60520635-60520657 GTTCCTTACATTTTAAACTAGGG - Intergenic
1175658262 20:60790731-60790753 GTTACTCACAGAGTACAGAAGGG + Intergenic
1175747981 20:61474665-61474687 TGTAATTACATTTTAAAGAAAGG - Intronic
1177949786 21:27520540-27520562 ATTCCTCATATTTTAAAGATGGG - Intergenic
1178166393 21:29983114-29983136 GTTAGTCACATTTAAAGGAAAGG - Intergenic
1178473892 21:32919579-32919601 GTTTCTCTCATTTTCAAGTAAGG + Intergenic
1180659797 22:17456650-17456672 GTTACTCTTTTTTTAAAAAAGGG - Intronic
1182118437 22:27771806-27771828 GTTACCCCCATTTTAAAGACTGG + Intronic
1184328901 22:43813053-43813075 GTTACTCCCATTTTACAGATAGG + Intergenic
949150811 3:765130-765152 GCTATTCATATTTCAAAGAATGG + Intergenic
949169310 3:979716-979738 GCAACTCAGATTTTAAAGACTGG - Intergenic
950659267 3:14456709-14456731 GTTATTCTCATTTTACAAAAGGG + Intronic
950944463 3:16930246-16930268 GTTTCCCTCATTTTAAAGACAGG + Intronic
950957278 3:17067680-17067702 GTTATTCTTATTTTAGAGAAGGG - Intronic
951319244 3:21225302-21225324 CTTATTCATATTTTAAAGAGAGG - Intergenic
952197832 3:31094636-31094658 ATTACTCTCATTTTACAGACAGG + Intergenic
952281190 3:31924930-31924952 GTTACTGAAATTTGAATGAATGG - Intronic
953231391 3:41068081-41068103 TTTAATCACAGTTTAAAGAAAGG - Intergenic
953253642 3:41268278-41268300 GTTAGTAACCTTTCAAAGAAAGG - Intronic
955027269 3:55181102-55181124 GTTACTGTCCTTTTTAAGAATGG + Intergenic
956037102 3:65105658-65105680 AATACTCACATTTTACGGAAAGG + Intergenic
956968500 3:74492380-74492402 GTAACTAAGATTTAAAAGAAGGG - Intronic
957017426 3:75084306-75084328 GTCATACACATTTTAGAGAATGG + Intergenic
957220652 3:77378344-77378366 GTTATCCCCATTTTATAGAATGG + Intronic
957326351 3:78700118-78700140 GCTACTCACATTTTAAATATCGG + Intronic
957473232 3:80688419-80688441 TTTACACACATTTAAGAGAAAGG - Intergenic
957657431 3:83098982-83099004 GTAATTCACATTTTAAGAAATGG - Intergenic
957745885 3:84341612-84341634 GTTGCTCCCATTTTAAAAGATGG + Intergenic
958036272 3:88173514-88173536 GTGACTCCCATTGTAAAGACTGG - Intergenic
958772558 3:98443403-98443425 GTTATTCACATACAAAAGAATGG - Intergenic
959220530 3:103513465-103513487 GTCAATCACACTTTAAATAATGG + Intergenic
959246333 3:103874181-103874203 GTGACTCACATATCAAGGAAAGG - Intergenic
959602014 3:108197865-108197887 GTTATTCTCATTTTACAGATGGG - Intronic
959765949 3:110028347-110028369 GCTGCTCACATTTAAGAGAAGGG - Intergenic
959779426 3:110210900-110210922 TTTATTCACATCTTAAATAATGG + Intergenic
960959441 3:123059263-123059285 ATTATTCCCATTTTACAGAAGGG + Intergenic
961738914 3:129020330-129020352 CTTACTCCCATTTAAAAGATTGG + Intronic
962061234 3:131929745-131929767 GGTACTCACTTTTGACAGAATGG - Intronic
963397424 3:144751246-144751268 CTCACTGAAATTTTAAAGAAGGG + Intergenic
964033039 3:152162021-152162043 GTTACATGCATTTTAAAGATTGG - Intergenic
964197382 3:154080482-154080504 ATCACTCACATTTTAAATATTGG - Intergenic
965374642 3:167908236-167908258 TCTACTCACATTTTAAAAATAGG - Intergenic
966124582 3:176561330-176561352 GGTACCCACATTTCACAGAAAGG + Intergenic
966378577 3:179322240-179322262 TTTAGTCACATTTTACAAAATGG - Intergenic
966379493 3:179329785-179329807 TTTACCCACATTTTCAAGTAAGG - Intronic
966758244 3:183391475-183391497 GGTAGTCACATTTTATAAAAAGG + Intronic
967046028 3:185737430-185737452 GTTACTCCCATGTTATAAAAGGG - Intronic
967733073 3:192924215-192924237 ATCTCTCACATTTTAGAGAATGG + Intergenic
968149455 3:196325554-196325576 GTTATTCACATTTTTAAAATAGG - Intronic
968311922 3:197691106-197691128 CTGACTCACATATCAAAGAACGG - Intronic
969102176 4:4777409-4777431 TTTACTCCCATTTTACAGAAGGG - Intergenic
969199721 4:5593308-5593330 GTAACGCACACTTGAAAGAAGGG - Intronic
969533336 4:7741267-7741289 GTGACCCTCATTTTCAAGAAGGG + Exonic
970214812 4:13747822-13747844 GTTTCTCCCCTCTTAAAGAAGGG + Intergenic
970692578 4:18636542-18636564 ATTTCTCACTTTATAAAGAAAGG + Intergenic
970760307 4:19477782-19477804 TTTAATCACAATTTAAAAAATGG + Intergenic
971956393 4:33425024-33425046 TTTACTGCTATTTTAAAGAATGG - Intergenic
973549412 4:52017816-52017838 TTATGTCACATTTTAAAGAAAGG + Intergenic
974898004 4:67962531-67962553 TTAACTCCCATTTTAAAGCAAGG - Intronic
975023402 4:69519181-69519203 TTTACTCAGATTTTAAAGGACGG + Intronic
975939608 4:79626854-79626876 GATACTCACATTGTCCAGAAAGG - Intergenic
975978579 4:80128238-80128260 ATTATTCCCATTTTAAAGATAGG - Intergenic
976899920 4:90160026-90160048 GTTATTCTCATTTTACAGATTGG + Intronic
977061698 4:92266450-92266472 TTTAATCACATTTTAAAGTTTGG + Intergenic
977540337 4:98311454-98311476 TTTACTTACATTCTAAACAAAGG + Intronic
977746404 4:100553539-100553561 GTTACTAAAATTTTCAAGAATGG - Intronic
977880029 4:102193559-102193581 GCAACACACATTTTAAAGAAAGG - Intergenic
977916713 4:102602227-102602249 CTAAAGCACATTTTAAAGAATGG - Intronic
978396329 4:108284500-108284522 GTATCTCAAATGTTAAAGAATGG + Intergenic
978746384 4:112199312-112199334 GTTTCTCACAATTTGAAAAATGG - Intergenic
978934902 4:114362368-114362390 TTTACTTCCATTTTAAAGATAGG + Intergenic
979355388 4:119697598-119697620 GTTACCCTCATTTTACAGAATGG - Intergenic
980304190 4:131035572-131035594 GTTATTCAAATTATAAAGAAGGG + Intergenic
980619255 4:135277292-135277314 GTCATTCAGTTTTTAAAGAAAGG + Intergenic
982609274 4:157552607-157552629 TTTATCCACATGTTAAAGAAAGG + Intergenic
982626328 4:157771193-157771215 ATTACTGACCTTTTAAATAATGG - Intergenic
982957488 4:161790843-161790865 TGTACTAACATTCTAAAGAAAGG + Intronic
983431221 4:167653822-167653844 GATACTCACATCCTAAATAATGG - Intergenic
983758561 4:171374974-171374996 CTGAGTCACATTTCAAAGAAGGG - Intergenic
984439885 4:179753851-179753873 GTTTCTCACTTCTGAAAGAAAGG - Intergenic
984543959 4:181075655-181075677 GTTGCCCACATTTTAATGAGTGG + Intergenic
984748995 4:183253511-183253533 CTCACTCACATTTTAAAGATGGG + Intronic
985052937 4:186010816-186010838 GTTTCCCACAATTTAAAGATTGG - Intergenic
985096980 4:186422435-186422457 GTTTCTCTCATTTTAAAACATGG + Intergenic
985321587 4:188718110-188718132 GTGACTGCCATTTTGAAGAATGG + Intergenic
985451162 4:190063888-190063910 GAAACTAATATTTTAAAGAATGG - Intergenic
986533955 5:8767003-8767025 GTTAATCATATCTTAAAAAAAGG - Intergenic
987455554 5:18141145-18141167 GTGACACAGATTTTAAAGAAAGG - Intergenic
987515222 5:18898039-18898061 GTTACTCACATTTTTAGGTATGG + Intergenic
989046257 5:37276759-37276781 GTTACTCAAATTAAAAAGATTGG - Intergenic
989458156 5:41666226-41666248 ATTATTCTCATTTTATAGAATGG + Intergenic
990350287 5:54909099-54909121 GTCACTGACATTTTAAAGAGAGG - Intergenic
990678127 5:58211808-58211830 TTTAAGCACATTTTAAAGAATGG - Intergenic
991006194 5:61830491-61830513 ATTACTCCCATTTTAAAGGTAGG + Intergenic
991200738 5:63988576-63988598 TTTACTTCCATTTTAAAGAGAGG + Intergenic
991348717 5:65698401-65698423 ATTACCCACATTTTACAGATAGG + Intronic
992815798 5:80436142-80436164 GTTACTCCAAATTTGAAGAAAGG - Intronic
993048029 5:82891005-82891027 GTTATTCTCATGTTACAGAAAGG + Intergenic
993458309 5:88151044-88151066 GTTTCTCATATTCTCAAGAATGG + Intergenic
993686203 5:90941381-90941403 GTCATTCTCATTTTAAAAAATGG - Intronic
993850744 5:93005021-93005043 ATTCCTCTCATTTTAAAGACAGG + Intergenic
994690253 5:103009706-103009728 CTTACCCATATTTTAAAGAAAGG + Intronic
995639660 5:114240138-114240160 GTTACTATCATTTTAAAACATGG - Intergenic
995675195 5:114655257-114655279 CTTACTCCCATTTTAGAGATAGG + Intergenic
996201089 5:120674354-120674376 GTTAATTAACTTTTAAAGAATGG + Intronic
996524347 5:124462176-124462198 GTTGATGACATTTTGAAGAATGG + Intergenic
996665236 5:126051109-126051131 TCTACCCAGATTTTAAAGAATGG + Intergenic
997114857 5:131115437-131115459 TTTACTCTCATTTTAACCAAAGG + Intergenic
997363016 5:133307046-133307068 GTTATTCCCATTTTACAGATGGG + Intronic
998754453 5:145360574-145360596 TTTTCACACATTTTATAGAATGG - Intergenic
1000044381 5:157509687-157509709 GTTACTGACATTTTTTAGAAAGG + Intronic
1002905289 6:1443616-1443638 GTTACTCTCCTTTTATAGATGGG + Intergenic
1003028210 6:2577817-2577839 CTTATTCATATTTTAAAGATGGG + Intergenic
1003518492 6:6837271-6837293 CTTACTCTCATTTCAAAAAATGG + Intergenic
1003800874 6:9665472-9665494 ATTATTCACATTTTACAGATGGG - Intronic
1004089142 6:12481961-12481983 GTAACTCAAATTGTAAAAAAGGG + Intergenic
1004414233 6:15410329-15410351 GTTCTTCAGATTTTGAAGAAGGG + Exonic
1004515264 6:16317128-16317150 GTTCCACACATTTTCCAGAATGG + Intronic
1004794402 6:19064946-19064968 ATTACTTACATTTTTAAGAAAGG + Intergenic
1005351694 6:24942055-24942077 CTTTCTCAACTTTTAAAGAAAGG + Intronic
1006131181 6:31870429-31870451 GTTACCCCCATTTTACAGATGGG + Intronic
1007312780 6:40959964-40959986 GTTAGTCCCATTTTACAGATGGG + Intergenic
1007381589 6:41493720-41493742 GTTATTCCCATTTTATAGATAGG + Intergenic
1008719762 6:54334572-54334594 ATTACTCACATTTTAAAGACAGG + Intronic
1009502502 6:64432870-64432892 GGTGCTCATATTTTAATGAAAGG - Intronic
1010354619 6:74917319-74917341 GTATCTCTCATTGTAAAGAAAGG - Intergenic
1011046351 6:83087656-83087678 ATTACTCACATTTACAAGTAAGG - Intronic
1011803065 6:91040137-91040159 TTCAATAACATTTTAAAGAATGG - Intergenic
1011988098 6:93475527-93475549 CATAGTCACATTTTAAAGAAAGG + Intergenic
1013785476 6:113775019-113775041 ATTATTCACATTTTTAGGAAAGG - Intergenic
1014647138 6:123988011-123988033 GTTACTGGGATTTTAAAGCAAGG + Intronic
1015087999 6:129319352-129319374 GCCACTCACATTTTAAAAAGTGG + Intronic
1015225198 6:130849756-130849778 TTTCCTCACAGTTTAAACAAGGG + Intronic
1016079802 6:139842176-139842198 ATTATTCTCATTTTAAAAAAGGG + Intergenic
1016644072 6:146383735-146383757 GTTTCTATCATTTTAAAGTATGG + Intronic
1016701942 6:147064281-147064303 GCTCCTCACATCTTAAAGGATGG + Intergenic
1017348928 6:153417067-153417089 ATTACTTAGATTTAAAAGAATGG + Intergenic
1017901180 6:158719787-158719809 GTTACTCCCATGATAAAGATCGG + Intronic
1018076622 6:160222110-160222132 GTTATCCTCATTTTACAGAAAGG + Intronic
1018350545 6:162955104-162955126 GTTGCTCACACTTACAAGAAGGG + Intronic
1020130665 7:5556860-5556882 GTTTTTCACATTTTACAGACTGG - Intronic
1020249189 7:6453696-6453718 GGTATGCACATTCTAAAGAAAGG + Intronic
1020277884 7:6635998-6636020 GTTAATAACATTTTAAAATAAGG - Intergenic
1020585498 7:10060702-10060724 GTAAATAACTTTTTAAAGAAAGG - Intergenic
1020927229 7:14345637-14345659 GTTCATCACATTTTAAAAAACGG + Intronic
1021207673 7:17805366-17805388 GTTATTACCATTTAAAAGAAAGG - Intronic
1022227237 7:28375895-28375917 ATTACTCCCATTTTACAGATGGG + Intronic
1022851232 7:34264355-34264377 ATTACATACATTTTAAAGTACGG + Intergenic
1023062875 7:36345642-36345664 GATATCCACATTTAAAAGAATGG + Intronic
1023174512 7:37422961-37422983 GTTACCCTCATTTTACAGATGGG + Intronic
1024312659 7:47983643-47983665 ATTATTCCCATTTTAAAGATGGG + Intergenic
1024396445 7:48874423-48874445 CTTGCTCACATTATTAAGAATGG + Intergenic
1026029750 7:66780308-66780330 GTCACTTACATAGTAAAGAATGG - Intronic
1026111649 7:67463214-67463236 ATTACTCTCACTTCAAAGAAAGG + Intergenic
1026293605 7:69030686-69030708 ATTACCCACATTTTAGAGGAAGG + Intergenic
1028419563 7:90617539-90617561 GTTACACACATTTTACAGAGAGG + Intronic
1029264524 7:99327674-99327696 GTTAATCACAGTTAAAGGAAGGG + Intronic
1030059595 7:105612262-105612284 GTTACTCTCCTTTTACAGATGGG - Intronic
1030096566 7:105906007-105906029 ATTACCTACATTTTACAGAAAGG + Intronic
1030877945 7:114838700-114838722 GTTACTCAGATTTTACAGAGAGG + Intergenic
1030890873 7:114997443-114997465 CTCTCTCAGATTTTAAAGAAAGG + Intronic
1031089940 7:117342227-117342249 GTAAATGACATTTTCAAGAATGG - Intergenic
1031357596 7:120806349-120806371 ATTAATCACATTTTAATAAAGGG - Intronic
1031602156 7:123723054-123723076 GTTAGTCCCATTTTATAGATGGG - Intronic
1031771555 7:125850771-125850793 TTTTCCCACATTTTAAAGACTGG + Intergenic
1034480744 7:151318767-151318789 GTTACCCACATTCTAAAAACAGG + Intergenic
1036343999 8:7943919-7943941 ATATCTCACATTTTAAAAAAAGG - Intronic
1036839342 8:12104686-12104708 ATATCTCACATTTTAAAAAAAGG - Intronic
1036861130 8:12350929-12350951 ATATCTCACATTTTAAAAAAAGG - Intergenic
1037015078 8:13894271-13894293 ATTACTCTGATTTTAAAAAAAGG + Intergenic
1037080469 8:14779155-14779177 GTTCCTCACATATTAAATCATGG + Intronic
1037535740 8:19822294-19822316 AATAATCACATTTTAAAGACTGG - Intronic
1037927836 8:22858503-22858525 GTTACTCAGATTTCAAAGTATGG + Intronic
1038838401 8:31155033-31155055 GTTAGTCCCATTTTAAAATATGG - Intronic
1040007433 8:42632238-42632260 ATCACTCACATTTTAGAAAAAGG - Intergenic
1041755876 8:61312730-61312752 GTTATTCTCATTTTAAATACAGG + Intronic
1041926311 8:63241052-63241074 GTTACACACATTTTCAATAATGG + Intergenic
1042132984 8:65607372-65607394 TTTCCTCACATTTAAAATAAGGG - Intronic
1042501322 8:69512545-69512567 GTTATCCACATTTTACAGAAAGG - Intronic
1042708349 8:71686855-71686877 ATTACTCAAAATTTAAAGCATGG - Intergenic
1043056249 8:75443357-75443379 GTTATTCTCATTTTAGAGACTGG - Intronic
1044758697 8:95493892-95493914 GTTATTAACATTTTAAAAGACGG - Intergenic
1045549083 8:103154211-103154233 GTTATTTCCATTTTACAGAAGGG + Intronic
1045749525 8:105466432-105466454 GTTTCTCACATTTTAAAATTTGG + Intronic
1045809126 8:106201029-106201051 GGTAGACACATTTTAATGAATGG - Intergenic
1045893596 8:107187104-107187126 GTTACTCAGATCTTCAAGGAGGG - Intergenic
1045943829 8:107771381-107771403 GTTTCTCTTATTTTGAAGAATGG + Intergenic
1046030622 8:108779409-108779431 GTTACCCAAATTTGAAACAAAGG + Intronic
1046417025 8:113930549-113930571 CTTTATCACATTTTAAAAAAAGG + Intergenic
1046554606 8:115759295-115759317 GTGACACACATTTTAAAGAGTGG - Intronic
1046558530 8:115808006-115808028 GTACTTCACATTCTAAAGAATGG - Intronic
1046834446 8:118783723-118783745 GATAATCTCATTTTGAAGAAGGG + Intergenic
1047323866 8:123817719-123817741 GGTAGTCACATTTAAAAGGATGG + Intergenic
1048218257 8:132516524-132516546 GTTACTCACACTGCAATGAAAGG - Intergenic
1048237207 8:132702713-132702735 TTTAGTCTCATTTTAAAGACTGG + Intronic
1048761624 8:137801788-137801810 GTCACTCTCATTTTAAAAAAAGG - Intergenic
1050595467 9:7200298-7200320 TTTACTCACTTTTTAGAGACAGG - Intergenic
1050626180 9:7506046-7506068 GTTACCTTCATTTTATAGAAGGG - Intergenic
1051062582 9:13061705-13061727 ATTACTCAGAATTTAATGAAGGG + Intergenic
1051791408 9:20807025-20807047 GTTATTTTCATTTTAAAGACAGG - Intronic
1052275745 9:26674512-26674534 GTTATTCACATTTAACAGAGGGG - Intergenic
1052756756 9:32550403-32550425 GTTATTCCCATTTTACAGACAGG + Intronic
1052927066 9:34026731-34026753 TTTACTCCCATTTTACAGAGAGG + Intronic
1053812884 9:41872999-41873021 TTTACTAACATATTAAATAATGG + Intergenic
1054617711 9:67314440-67314462 TTTACTAACATATTAAATAATGG - Intergenic
1055200700 9:73656704-73656726 TTTACTCATATTTTAAAAAGGGG + Intergenic
1057986877 9:99726066-99726088 GTTACTCACACTTTTCAGACAGG - Intergenic
1058354687 9:104070216-104070238 TTCTCTCCCATTTTAAAGAAAGG + Intergenic
1059513786 9:114874418-114874440 CTTACTCCCATTTTACAGATGGG + Intergenic
1059928718 9:119239692-119239714 ATTACTAACATTTTATAGATGGG - Intronic
1059959247 9:119549301-119549323 GTTACTAATATTTTACAGATGGG - Intergenic
1060300200 9:122370660-122370682 GTTAGACCCATTTTACAGAAGGG + Intronic
1060766695 9:126299335-126299357 ATTAGTCCCATTTTAAAGATGGG - Intergenic
1060998893 9:127891131-127891153 GTTATGCCCATTTTAAAGACAGG + Intronic
1061238222 9:129354153-129354175 CTTACTCCCATTTTACAGATGGG + Intergenic
1061409226 9:130409693-130409715 ATCACTCCCATTTTACAGAAGGG + Intronic
1061515629 9:131088313-131088335 GTTACTCCCATTTTCCAGATGGG - Intronic
1061791722 9:133062714-133062736 GTTGTTCCCATTTTACAGAAGGG + Intronic
1061795398 9:133083280-133083302 GTTGTTCCCATTTTACAGAAGGG + Intronic
1062415298 9:136445970-136445992 GTTATTCCCATTTTACAGAGGGG + Intronic
1186125816 X:6412843-6412865 GTTAATTATATTTTAAAGACTGG - Intergenic
1186547787 X:10468805-10468827 GTTACTAACATTTTAAGTGATGG + Intronic
1187592607 X:20734872-20734894 GGGCCTCTCATTTTAAAGAAGGG + Intergenic
1188296272 X:28453495-28453517 TTTATTCACATTTTAAAAAGAGG - Intergenic
1188350042 X:29118337-29118359 GTTATTCCTATTTTACAGAATGG + Intronic
1188523179 X:31060944-31060966 GTTTCTCACATTTTTAATATGGG + Intergenic
1188536298 X:31200689-31200711 GATACTGACATTTTCAAGGACGG + Intronic
1188633406 X:32397689-32397711 ATTAATCACATTTTAAATATAGG + Intronic
1188742585 X:33804384-33804406 CATAATCACATTGTAAAGAATGG + Intergenic
1189367001 X:40396510-40396532 GTTGTTGACATTTTGAAGAAGGG - Intergenic
1189540292 X:41980438-41980460 GTTACTCATACAGTAAAGAAGGG + Intergenic
1192597840 X:72430149-72430171 TTTCCTCTCATTTTAGAGAAAGG + Intronic
1192778209 X:74266856-74266878 GGTAGGCTCATTTTAAAGAAGGG - Intergenic
1192862954 X:75097999-75098021 TTTACTCAGATTTTAAAGTCAGG - Intronic
1194806865 X:98340014-98340036 TTTTCCCACATTTTAATGAAAGG + Intergenic
1195588108 X:106589460-106589482 ATTACTCACACTTTAAACCATGG - Intergenic
1196129479 X:112139310-112139332 GTGACTTTCTTTTTAAAGAATGG - Intergenic
1196470253 X:116015813-116015835 GTTACCCACATTTTACAGTGGGG + Intergenic
1196676513 X:118426165-118426187 GGTAATCATATTTAAAAGAAGGG + Intronic
1196766019 X:119244042-119244064 GTTACTCTCATTTGAAATGAGGG + Exonic
1202084036 Y:21116966-21116988 GTTCATCACATTGTAAAAAATGG + Intergenic
1202580014 Y:26370543-26370565 GTTATTCCCATTTTATAGATGGG - Intergenic