ID: 907081691

View in Genome Browser
Species Human (GRCh38)
Location 1:51629460-51629482
Sequence TTGTGTGGATGTCATAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907081691 Original CRISPR TTGTGTGGATGTCATAAAGT GGG Intronic
901634058 1:10661974-10661996 TTGTGTGCATGTAATTAACTGGG - Intronic
903399960 1:23035561-23035583 TTGTGTGGTTTTAATAAATTTGG + Intronic
907081691 1:51629460-51629482 TTGTGTGGATGTCATAAAGTGGG + Intronic
908475784 1:64486880-64486902 TTCTGTGAAGGACATAAAGTAGG + Intronic
908943606 1:69466814-69466836 TTGTGTGTATTTCACAAAGGAGG - Intergenic
910345877 1:86237405-86237427 TTAAGTGGATATCATATAGTGGG - Intergenic
911521501 1:98935482-98935504 TGGTGTTGATATCATAAATTGGG - Intronic
911557922 1:99368119-99368141 GTGTATGGATGTGATAAACTAGG + Intergenic
911573903 1:99551267-99551289 TTTTCTGAATGACATAAAGTAGG - Intergenic
916754617 1:167757083-167757105 TTGGCTGGATGGCACAAAGTAGG - Intronic
919103128 1:193118039-193118061 TTTTGTGGATAACATAGAGTTGG - Intergenic
920776147 1:208939079-208939101 TTGTGTGGATGACAAAAAGTGGG + Intergenic
921578578 1:216867978-216868000 TTTTGTGAATGTCATAAAATGGG + Intronic
922084557 1:222333529-222333551 TTAGGTGGCTGTCATAAATTTGG - Intergenic
922125700 1:222720459-222720481 ATGTGTGCATTTCATAAATTTGG + Intronic
922754788 1:228089703-228089725 TGGTGTTGCTGTCATAAACTGGG - Intronic
923287248 1:232508305-232508327 TGGTCTGGGTGGCATAAAGTAGG + Intronic
923423525 1:233844710-233844732 TTGTGTGAATGCTGTAAAGTTGG - Intergenic
1064750248 10:18521258-18521280 AGGTGTGGATGTCCTGAAGTTGG - Intronic
1065611470 10:27475284-27475306 TGGTATGGGTGTCCTAAAGTTGG - Intergenic
1067856463 10:49797631-49797653 TTTTGTATATGTGATAAAGTAGG - Intergenic
1067956554 10:50797456-50797478 TTGTGTGAATATCAGGAAGTGGG + Intronic
1069432289 10:68348568-68348590 TTGTATGGTTTTCATCAAGTTGG - Intronic
1069995871 10:72341924-72341946 TTTGGTGGTTTTCATAAAGTCGG - Intronic
1072759821 10:98047303-98047325 ATGTGTGAATATCAGAAAGTGGG - Intergenic
1075653854 10:124148156-124148178 TTTTTTGGTTGTCATAAGGTGGG - Intergenic
1076109029 10:127847067-127847089 TTGTGTGGATGTAATAGAGAGGG + Intergenic
1077677860 11:4213401-4213423 TTGTTTGGATGAAATAAACTTGG + Intergenic
1078625438 11:12951792-12951814 TTGAGTAGATGTCTTAATGTAGG - Intergenic
1078872328 11:15360017-15360039 ATATGTGGATGACAAAAAGTTGG - Intergenic
1079978868 11:27127981-27128003 TTGTTTAGATGTCATAATTTAGG - Intergenic
1080210847 11:29782969-29782991 TAATGTGGATGTCAAAATGTGGG + Intergenic
1088965135 11:114712624-114712646 TTGTGAGGATGTGAAGAAGTTGG + Intergenic
1089719350 11:120398578-120398600 TTGTGTGTGTGTGATAAACTAGG + Intronic
1090686792 11:129129778-129129800 TTGTGAGGTTGTCAGAAAATAGG - Intronic
1092577700 12:9806521-9806543 TTATGTAGATGGCATATAGTTGG + Intergenic
1095245655 12:39918148-39918170 ATATGTGGATGTCATAATTTGGG - Intronic
1095862438 12:46933024-46933046 TTTTGAGGATGTCATATAATTGG - Intergenic
1096168893 12:49450163-49450185 TTTTGTAGATGGCATACAGTTGG + Intronic
1096203588 12:49704098-49704120 TTGTGTGGATTTAATGAAATTGG - Intronic
1097671335 12:62542734-62542756 ATGTGTGAATGTCAAGAAGTAGG - Intronic
1098164565 12:67680683-67680705 TTGTGTGTATGTGATGTAGTAGG + Intergenic
1099678927 12:85798977-85798999 TTGTGTTACTGTCATAAATTAGG - Intergenic
1100342501 12:93693324-93693346 TTTTGTGGATGGCATATAGTTGG - Intronic
1103113615 12:118305599-118305621 TTTTATGCATGTCAAAAAGTTGG + Intronic
1105596141 13:21840981-21841003 TTGAGTTGATGTCTTAAATTTGG + Intergenic
1106850898 13:33790253-33790275 TGGTGTGGATGTGATAAAAAGGG + Intergenic
1107185063 13:37508205-37508227 TTGTGTGGATGTGGTGAAGAGGG + Intergenic
1109089814 13:58027741-58027763 TTTTGTGGATTTTCTAAAGTAGG + Intergenic
1109567614 13:64138114-64138136 TTGTCTGTGTGTCAAAAAGTTGG - Intergenic
1110656366 13:78004866-78004888 TAGTGTTGATGTCATAGAGCAGG + Intergenic
1111228595 13:85310054-85310076 TTCTGAGAATGTCATATAGTTGG - Intergenic
1111934469 13:94545499-94545521 TTTTGTGGTTGGCCTAAAGTTGG - Intergenic
1112020478 13:95367011-95367033 TTGTGTGGATCACCTGAAGTCGG - Intergenic
1117779347 14:59216377-59216399 TTGTCTGTATTTCATAGAGTAGG + Intronic
1121878752 14:97480042-97480064 TGGTGTGTATGACATACAGTAGG + Intergenic
1122027854 14:98890590-98890612 TTTTATTGATGTCATAAAGTAGG + Intergenic
1123962202 15:25415386-25415408 TGGTGATGATGTCATATAGTGGG - Intronic
1128039868 15:64562552-64562574 TTGTGTGGCTGTGATATAGAAGG - Intronic
1130865934 15:87933390-87933412 GGATGTGGATGTCAGAAAGTGGG - Intronic
1130875675 15:88011996-88012018 CTGTGTGTCTGTCATAAGGTGGG - Intronic
1131713087 15:95077031-95077053 TTCTGTGGATCTCATCAATTGGG + Intergenic
1134221795 16:12360739-12360761 TTTTGTGGATTTCTTTAAGTAGG + Intronic
1135501775 16:23002104-23002126 TGGTGTGGATGTGATAAAAAGGG - Intergenic
1135665075 16:24328899-24328921 ATGTGTGTATGTGATGAAGTCGG - Intronic
1137693369 16:50445497-50445519 CTGAGTGCATGTCAGAAAGTGGG + Intergenic
1139202977 16:64997964-64997986 TTATGTGCATGTTATAAAGAAGG + Intronic
1139219057 16:65160419-65160441 ATGTGTGCATGCCATAAAGAGGG - Intergenic
1139273779 16:65707765-65707787 CTGGGTGGATTTCATATAGTGGG - Intergenic
1141791827 16:86242239-86242261 GTGTGTGGATGTCAGAACATCGG - Intergenic
1142294986 16:89215391-89215413 TTGGCTGGATGTGGTAAAGTTGG + Intergenic
1147287746 17:39416098-39416120 ATCTGTGGATGACATATAGTAGG - Intronic
1154970435 18:21403052-21403074 TTGTATGTATCTCATAAACTTGG + Intronic
1155607003 18:27617805-27617827 CTGAGTCAATGTCATAAAGTAGG - Intergenic
1158220083 18:55141483-55141505 GTGGGTGGATTTCATAGAGTTGG - Intergenic
1158521939 18:58178652-58178674 TTGTGTTGATATTATACAGTAGG - Intronic
1161837191 19:6655735-6655757 TTTTGTGCATGACACAAAGTTGG + Intergenic
1163825627 19:19522802-19522824 TTTTGTGGATGGTATAAAGAAGG + Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
928931398 2:36628792-36628814 TTCTGTGGATGTAAGCAAGTTGG - Intronic
929828072 2:45325563-45325585 CTGTGTGGATCTCATAAAGCTGG - Intergenic
931633785 2:64323919-64323941 TTGTGTGAATGGCACAAAGTCGG + Intergenic
935209586 2:100927296-100927318 TTTTGTAGATGTCGTAAGGTGGG + Intronic
937074754 2:119094436-119094458 TTTTGTAGATGTAATATAGTTGG + Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
938342995 2:130547745-130547767 TTGTGTGGATGGCCTAGAGCTGG + Intronic
938346838 2:130572977-130572999 TTGTGTGGATGGCCTAGAGCTGG - Intronic
939234885 2:139478302-139478324 GTGTCTGGAAGTCATAAAGTTGG + Intergenic
939744736 2:145954543-145954565 TTGTGTGGATGTGTTAAAAAGGG - Intergenic
940381125 2:153016464-153016486 CTATGTGGATGGCATAAATTTGG + Intergenic
942531043 2:176910836-176910858 TTGTCTTGATGACAAAAAGTAGG + Intergenic
942833016 2:180258994-180259016 TTTTCTTGAGGTCATAAAGTTGG + Intergenic
944321799 2:198354209-198354231 TTGTATGGATAGCATAAGGTTGG + Intronic
945337606 2:208611321-208611343 TGGTGTGGATGTGATAAAAAGGG - Intronic
945531388 2:210958058-210958080 TTATCTGGATTTCAGAAAGTAGG + Intergenic
946284672 2:218693978-218694000 TTGTGGGTAAGTCATAAAGTAGG + Exonic
946790431 2:223295800-223295822 AAGTCTGGATGTCATAAGGTAGG - Intergenic
948228605 2:236333454-236333476 TTGTTTAGATGTTATAAATTTGG - Intronic
1170385078 20:15807424-15807446 GTGTGTGTATGTACTAAAGTAGG - Intronic
1176659634 21:9622303-9622325 TTGTGTGGATGACATTATGATGG + Intergenic
1177671370 21:24234174-24234196 TTTTGTAGATATCATATAGTTGG + Intergenic
1181272776 22:21669471-21669493 CTGTGTGGCTGACATATAGTAGG + Intronic
1181941503 22:26481167-26481189 TTATGTGGAAGTCAAAAAGATGG - Intronic
1182811038 22:33116758-33116780 CTGTGAGGTTTTCATAAAGTGGG + Intergenic
1182856845 22:33525074-33525096 ATGTGTTGATGTCATCAAGATGG + Intronic
1182992368 22:34780485-34780507 TTTTGAGGATGTCATACAGATGG - Intergenic
1183690544 22:39385486-39385508 ATGGATGGATGTCATAAAGGAGG - Exonic
1185167635 22:49271384-49271406 TTCTGTGGATGTGAAGAAGTTGG + Intergenic
951113639 3:18834576-18834598 TTGTGGGGTTATCATAATGTTGG - Intergenic
953872523 3:46639589-46639611 TTGTGTTGATGTCCTATAGAGGG - Intergenic
954590911 3:51780851-51780873 TTGTGTGCTTTTCTTAAAGTAGG + Intergenic
955033150 3:55240501-55240523 TTCTGTGGATGTCAATGAGTAGG - Intergenic
955869876 3:63426370-63426392 CTTTGTGGCTGACATAAAGTAGG - Intronic
956548361 3:70432882-70432904 TTTTCAGTATGTCATAAAGTTGG + Intergenic
956681224 3:71784176-71784198 TTGTGTGGATCTGAAAAAATTGG - Intronic
957296088 3:78334612-78334634 TTGTGTGAAGGTTGTAAAGTCGG + Intergenic
958475712 3:94578753-94578775 TTTTGAGGATGTCAAATAGTTGG - Intergenic
963070987 3:141305130-141305152 TTGTGTGGACGTAACAGAGTAGG - Intergenic
964489451 3:157219736-157219758 GTGTGTGTATGAAATAAAGTAGG - Intergenic
966568152 3:181406667-181406689 TTGTGTGAATGTTATATAGGTGG - Intergenic
966957151 3:184894273-184894295 TTGGGTGGACATCATGAAGTAGG - Intronic
967849201 3:194070058-194070080 TTGTGTGGAAATCAAAAAGGAGG + Intergenic
967950934 3:194839977-194839999 TTGTGTAGATGTCATAAATTGGG - Intergenic
969570662 4:8006361-8006383 CTGTGGGGAGGTCATCAAGTGGG + Intronic
970424972 4:15937620-15937642 TTGTGTGGATTTCACAAGGTGGG - Intronic
971300520 4:25438500-25438522 TTGAGTGGGGGGCATAAAGTGGG - Intergenic
971392790 4:26201749-26201771 TTGAGTGGAGGGCATGAAGTAGG - Intronic
971880058 4:32359959-32359981 TTATATGGATATCATAAAATAGG + Intergenic
976166581 4:82262603-82262625 TTTTGTAGATGGCATACAGTTGG + Intergenic
977147472 4:93462591-93462613 TTTTGTGGATATGAGAAAGTTGG - Intronic
979563470 4:122126759-122126781 TTATTTGGATGGCATAAGGTAGG + Intergenic
979985021 4:127303146-127303168 TTGTGTGGAGGTAAAAAAGAAGG + Intergenic
983460423 4:168019458-168019480 TTATGTGGATGTCAGAGAGCTGG - Intergenic
984485636 4:180365258-180365280 TTATGAGGATGTCACACAGTAGG + Intergenic
985415737 4:189734110-189734132 TTGTGTGGATGACATTATGATGG - Intergenic
985927835 5:3031672-3031694 TTGTTGGAAAGTCATAAAGTTGG - Intergenic
986633072 5:9793504-9793526 TTGTGGGGGTGTCATAAGATAGG + Intergenic
987823710 5:23000383-23000405 TAGTGTGAATGTCAGAAAATTGG + Intergenic
991379941 5:66010065-66010087 TTGTGAGGATGTCAAGAAATTGG - Intronic
992599404 5:78383081-78383103 TTGTGTGGATGTGGTAAAAAGGG - Intronic
994521213 5:100838906-100838928 TAATGTGGATGTCATAGTGTTGG - Intronic
995359903 5:111283988-111284010 TTGTGAGGCTTTCATAAAATAGG + Intronic
995682720 5:114738544-114738566 ATGTCTGGATATTATAAAGTTGG + Intergenic
997331051 5:133062095-133062117 TTGTGTGGATGAAATACAGCTGG + Intronic
998846602 5:146316384-146316406 GTGTGTGGTAGTAATAAAGTTGG - Intronic
999652588 5:153782141-153782163 TTGTGAGGATTACATAAATTAGG - Intronic
1000090356 5:157924787-157924809 TTTTGTGGGTGTCATAGAGTAGG + Intergenic
1000197800 5:158976469-158976491 TTCTGTGGATTTCAAAAAGATGG + Intronic
1000280487 5:159777556-159777578 TTGTGTGGGCGTCATTCAGTGGG + Intergenic
1000383373 5:160649039-160649061 TTGTGTGTGTGTGATAAAGAGGG - Intronic
1000725916 5:164770498-164770520 TTGTGTTGTTGTCATATAATAGG + Intergenic
1001414632 5:171536410-171536432 TTCACTGGATGTCATAAAATTGG + Intergenic
1004190865 6:13462333-13462355 ATTTGTGAATGTCATAAATTAGG + Intronic
1004926054 6:20416176-20416198 TATTGTGGTTGTCATTAAGTTGG + Intronic
1005155252 6:22797710-22797732 TTGTGTGGCTGTCATTTTGTAGG + Intergenic
1007330589 6:41104219-41104241 GTGAGTTGATGGCATAAAGTGGG + Intergenic
1009422023 6:63474099-63474121 ATGTGTGAATGTCATAATATGGG - Intergenic
1010157940 6:72816603-72816625 TGATGTGGATTTCATAAAATTGG - Intronic
1011672134 6:89693568-89693590 TTGTCTGGCAGTCAAAAAGTTGG - Intronic
1011946604 6:92912437-92912459 TTGAGTGGTTGTCAGAAAGAAGG + Intergenic
1013621005 6:111889046-111889068 TTGGGTCGATGCCAAAAAGTAGG + Intergenic
1014471277 6:121817645-121817667 CTGTATGGATGGCATAAATTAGG + Intergenic
1014567474 6:122967732-122967754 TTGTGTGGAAAGTATAAAGTTGG + Intergenic
1014757183 6:125314350-125314372 TTATAAGGAAGTCATAAAGTGGG - Intergenic
1015084435 6:129271831-129271853 ATGTGTAGATGTGATCAAGTAGG + Intronic
1015611148 6:135020856-135020878 ATGTGTGGTTGTCAGAAACTAGG + Intronic
1016312829 6:142753187-142753209 TTGTGTGGATGACAAGCAGTTGG - Exonic
1022714059 7:32881925-32881947 TTGAGAGGATTTCATAATGTAGG - Intronic
1026080306 7:67212361-67212383 TTGTGTGGATGTACCACAGTTGG + Intronic
1026696784 7:72601641-72601663 TTGTGTGGATGTACCACAGTTGG - Intronic
1026731402 7:72914783-72914805 TCGTGTGGGTGTCACACAGTTGG + Intronic
1027112637 7:75453040-75453062 AGGTGTGGGTGTCATACAGTTGG - Intronic
1027493988 7:78864704-78864726 ATCTTTGGTTGTCATAAAGTAGG + Intronic
1028079769 7:86560692-86560714 TTCTGTGTATGTCATAATTTTGG - Intergenic
1028086369 7:86642450-86642472 TTGTGTGTATGGCGTAACGTGGG + Intergenic
1029942192 7:104492033-104492055 TTGTGTGGAGATCATTAATTTGG + Intronic
1032933843 7:136706046-136706068 TTGTTTTGATGTCATGAACTTGG - Intergenic
1033514285 7:142090727-142090749 TGGTGTGATTGTCATAAAGGAGG + Intronic
1036982922 8:13491174-13491196 TTGTGAAAATGACATAAAGTTGG - Intronic
1037148106 8:15598661-15598683 TTTTCAGAATGTCATAAAGTTGG + Intronic
1040652865 8:49468870-49468892 TTTTGTGGAAGGCATAAAGATGG + Intergenic
1041590822 8:59580689-59580711 TTGATTGGATATCTTAAAGTTGG - Intergenic
1041827497 8:62112807-62112829 TTTTGTGTATGGTATAAAGTAGG + Intergenic
1043786676 8:84410875-84410897 TTGTATGTATGTCATAAACCAGG - Intronic
1046413308 8:113876928-113876950 TTGTGTGTATGTTATAAGGAAGG + Intergenic
1046930844 8:119840438-119840460 TTGTGTGAAGGTCCTAAGGTAGG + Intronic
1047022594 8:120791813-120791835 TGGTGTGGATGTCATGAAAATGG + Intronic
1047858137 8:128935299-128935321 TTGGGTGGATGTGGTAACGTTGG - Intergenic
1052333426 9:27295490-27295512 TTTTGTGTATGGCATAAAGTAGG - Intronic
1053385494 9:37684017-37684039 TTGTGTGGGGGAGATAAAGTTGG + Intronic
1055751495 9:79511045-79511067 TTTTGTGTATGGCATAAATTAGG + Intergenic
1203637193 Un_KI270750v1:124146-124168 TTGTGTGGATGACATTATGATGG + Intergenic
1186864210 X:13702822-13702844 TTGTGTGGATGTCACAAACTTGG + Intronic
1186921124 X:14281494-14281516 TTGTGTGGATGTGGTAAAAAGGG - Intergenic
1188698250 X:33224494-33224516 TTTCCTGGATGTCATATAGTTGG - Intronic
1192614031 X:72599126-72599148 TAGTGTGGATATGATAGAGTTGG + Intronic
1193474765 X:81949556-81949578 TTCTTTGGATTTGATAAAGTTGG - Intergenic
1194277678 X:91907065-91907087 TTGTCTGTATGGCATGAAGTTGG - Intronic
1197147143 X:123183635-123183657 TTGTGTGTCTGTCTTAAAGAAGG - Intergenic
1197272258 X:124437422-124437444 GTGCTTGGATGTTATAAAGTTGG + Intronic
1197427741 X:126319179-126319201 GTGAATGGATGTCATAATGTAGG + Intergenic
1199121427 X:144058950-144058972 TTGTGTGACTGTCACATAGTTGG + Intergenic
1200595020 Y:5129142-5129164 TTGTCTGTATGGCATGAAGTTGG - Intronic