ID: 907087548

View in Genome Browser
Species Human (GRCh38)
Location 1:51690398-51690420
Sequence TTGTCGAAGTGGAAGTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907087543_907087548 3 Left 907087543 1:51690372-51690394 CCAGAGACTCACAGCATTGCCTC 0: 1
1: 0
2: 0
3: 17
4: 189
Right 907087548 1:51690398-51690420 TTGTCGAAGTGGAAGTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 97
907087541_907087548 26 Left 907087541 1:51690349-51690371 CCCACTACAGTGCTGACTTTGTT 0: 1
1: 0
2: 1
3: 16
4: 201
Right 907087548 1:51690398-51690420 TTGTCGAAGTGGAAGTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 97
907087542_907087548 25 Left 907087542 1:51690350-51690372 CCACTACAGTGCTGACTTTGTTC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 907087548 1:51690398-51690420 TTGTCGAAGTGGAAGTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907087548 Original CRISPR TTGTCGAAGTGGAAGTTGTG GGG Intronic
901348171 1:8566264-8566286 TTTTAGAAATGGGAGTTGTGTGG - Intronic
907087548 1:51690398-51690420 TTGTCGAAGTGGAAGTTGTGGGG + Intronic
908280083 1:62524348-62524370 TTCTAGAAGTGGAATTTGTTGGG - Intronic
912555800 1:110515140-110515162 ATCATGAAGTGGAAGTTGTGTGG + Intergenic
912576475 1:110675795-110675817 TTCACGAAGTCGAAGTTGTGTGG + Intergenic
918508393 1:185282870-185282892 TGGTCGACCTGGAGGTTGTGGGG - Intronic
923601579 1:235407790-235407812 TTGTTGAAGGGGTAGTTGAGGGG + Intronic
924170667 1:241336717-241336739 GTGAAGAAGTGGAAGTTTTGTGG + Intronic
1064695344 10:17959508-17959530 TCTTTGAAGTGGAAGTTTTGGGG - Intronic
1065543348 10:26793043-26793065 TAGTAGCAGTGGCAGTTGTGAGG - Intronic
1068589959 10:58843369-58843391 TTGTCAAAGTGGAAGTTGCCAGG - Intergenic
1070638498 10:78148463-78148485 TTCTGGCAGTGGAAGTAGTGGGG + Intergenic
1081693393 11:45093572-45093594 TTGTTGTAGTGGCAGTGGTGGGG - Intergenic
1089818772 11:121201818-121201840 TTTTGGAAGTTGAAGTTATGAGG + Intergenic
1092416869 12:8296808-8296830 TTGTCTTAGTGGGAGTTGTCGGG - Intergenic
1094059261 12:26296177-26296199 TTTCCCAAGTGGAAGATGTGTGG - Intronic
1097243564 12:57592403-57592425 CTGTGGAGATGGAAGTTGTGAGG + Intronic
1106841070 13:33685504-33685526 TTGTGGAAGGGGCAGTGGTGGGG - Intergenic
1111534361 13:89582868-89582890 AAGTGGAAGTGGAAGTTCTGAGG + Intergenic
1114757817 14:25280308-25280330 TTGGCGAGGTGGGGGTTGTGGGG - Intergenic
1120493765 14:85207972-85207994 TTTTGGAAGTGGAAGCTTTGTGG + Intergenic
1121866558 14:97367588-97367610 TTGTCAAAATGCAAGCTGTGGGG + Intergenic
1125443930 15:39732750-39732772 TTGTCAAAGATGAGGTTGTGGGG + Intronic
1126007440 15:44271648-44271670 CTGTACAAGTGGAAGTTGAGAGG + Intergenic
1129491256 15:75927862-75927884 TTGTCAAGGTGGAAGTCATGTGG + Intronic
1133412339 16:5579194-5579216 TAGTGGAAGTGCAAGTTGGGTGG - Intergenic
1134146438 16:11767686-11767708 TTGTGGAAGTGGGATTTCTGTGG - Intronic
1145041791 17:19582619-19582641 TGGTAGAAGGTGAAGTTGTGGGG + Intergenic
1145042619 17:19588091-19588113 TTGTAGAAGGTGAAGTTGTGGGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149916935 17:60618460-60618482 TTGTCGAACTTTAATTTGTGCGG + Intronic
1150830673 17:68516411-68516433 TTGTGCATGTGGAAGTTATGAGG + Intronic
1151134335 17:71931232-71931254 TTGGCGAAGATAAAGTTGTGCGG + Intergenic
1151380340 17:73721264-73721286 CTGGCGAAGTGGAACTTCTGGGG + Intergenic
1153043571 18:836063-836085 TTGTAGAAGTAGAAGATGGGAGG + Intergenic
1153326100 18:3821940-3821962 TTGTCAAGGTGAAAGCTGTGTGG - Intronic
1161741158 19:6021945-6021967 TAGTCGAAGTGGAGGAGGTGGGG + Intronic
1162714462 19:12621319-12621341 TTGTGAAAGTCTAAGTTGTGAGG + Intronic
926686047 2:15698492-15698514 TTCTAGAAGTTGCAGTTGTGGGG - Intronic
928224051 2:29432201-29432223 TGGTCGTAGTGGAAGGTGTTTGG + Intronic
929049490 2:37823923-37823945 GTGACGAAGTGGAAGTTGCAAGG + Intergenic
930601327 2:53446808-53446830 TTGTGCCAGTGGATGTTGTGTGG - Intergenic
933896710 2:86817283-86817305 ATCTGGAAGTGGAAGTTCTGGGG - Intronic
936244305 2:110813334-110813356 TTGTGGCAGTGGCAGCTGTGAGG + Intronic
937707914 2:124942421-124942443 TTGTAAAAGTGGAAACTGTGAGG + Intergenic
938717579 2:134035076-134035098 TTGAAGAAGTGTAAGTTATGAGG + Intergenic
939116513 2:138067770-138067792 TGGTTGAAGTGGAAGGAGTGAGG - Intergenic
941051716 2:160741959-160741981 TAGCTGAAGTGGAAGATGTGTGG - Intergenic
941438959 2:165509427-165509449 TAGTGGAAGTGAAAGATGTGGGG + Intronic
948957112 2:241302068-241302090 TTGTAGAGATGGGAGTTGTGGGG - Intronic
1169190890 20:3658705-3658727 AGGTTGAAGTGGAGGTTGTGGGG - Intergenic
1170850614 20:20000844-20000866 TAGACAAAGTGGAAGATGTGGGG - Exonic
1176104333 20:63378752-63378774 TTGTAGGAGTGGAAGCTGTTAGG + Intergenic
1182030410 22:27155015-27155037 TGGTGGAGGAGGAAGTTGTGAGG - Intergenic
1183130242 22:35827597-35827619 TGGCAGAAGTGGAAGGTGTGAGG - Intronic
1184759670 22:46537347-46537369 CTCTCGAAGTGGAAGCTGCGGGG - Intergenic
954990217 3:54834290-54834312 GTTGCAAAGTGGAAGTTGTGCGG + Intronic
958505661 3:94973901-94973923 CTGTTCAAGTGGAAGTGGTGGGG - Intergenic
958997363 3:100920199-100920221 TGGTCTAAGTGGCAGTTTTGTGG - Intronic
959343457 3:105161262-105161284 TTGTCAAAGTGGAATTTGACAGG - Intergenic
961292772 3:125860989-125861011 TTGTCTTAGTGGGAGTTGTCCGG + Intergenic
961894419 3:130155410-130155432 TTGTCTTAGTGGGAGTTGTCCGG - Intergenic
963016308 3:140827656-140827678 TTGTGGAACTGGAAGATGTTTGG - Intergenic
964692855 3:159472372-159472394 TTGACAAAATGGAAGTTGTGAGG - Intronic
965298792 3:166984146-166984168 CTGTTGAAGTGAAAGTTGTCAGG + Intergenic
965772947 3:172199852-172199874 TTTGCGAAGTGAAAATTGTGAGG + Intronic
972110830 4:35557209-35557231 CTGTGGAAGTGGAAGTGGTATGG - Intergenic
975752171 4:77535084-77535106 TTGTGGAAGAGGACATTGTGAGG - Intronic
977549238 4:98422899-98422921 TTGGCAAGGTGGAAGTTGTCAGG + Intronic
978619954 4:110628256-110628278 TTGCTGAAGTGAAAGATGTGGGG + Intronic
979095059 4:116537583-116537605 TTGAATAAGTGGAAGATGTGGGG - Intergenic
979733413 4:124052554-124052576 TTGGCTAAGGGGAAGATGTGGGG + Intergenic
984980984 4:185281075-185281097 GTGTAGCAGTGGAAGCTGTGGGG - Intronic
989230099 5:39074973-39074995 TTCTCCAAGTGGAAGTGGTTAGG + Intergenic
992079220 5:73218280-73218302 TTGTGGAAATGGTAGATGTGAGG - Intergenic
1001974394 5:175985031-175985053 TTGTAAAAGTGGATGTTTTGGGG + Intronic
1002243040 5:177858748-177858770 TTGTAAAAGTGGATGTTTTGGGG - Intergenic
1008154147 6:47993402-47993424 TTCTCCAAGTGGAAGTCTTGAGG - Intronic
1008335875 6:50303994-50304016 TGGTCAAAAGGGAAGTTGTGGGG + Intergenic
1010625139 6:78130147-78130169 TTGTGGAAGGGGAAGATCTGTGG - Intergenic
1020324651 7:6964988-6965010 TTGTCTTAGTGGGAGTTGTCCGG - Intergenic
1027441060 7:78219661-78219683 TTGGAGAAGGGCAAGTTGTGGGG - Intronic
1028046676 7:86129165-86129187 TTGTGGCATTGGCAGTTGTGAGG + Intergenic
1029614944 7:101650370-101650392 TGGTTGAGGTGGAAGGTGTGGGG + Intergenic
1032003788 7:128284042-128284064 TTTTCAAAGTGGAATTTTTGGGG - Intergenic
1032292438 7:130600844-130600866 TTGTAGAAGTGGATATTTTGGGG - Intronic
1036371417 8:8165953-8165975 TTGTCTTAGTGGGAGTTGTCCGG + Intergenic
1036879486 8:12499691-12499713 TTGTCTTAGTGGGAGTTGTCCGG - Intergenic
1038627330 8:29206844-29206866 TTGCGGAAGTGGAAGTGGGGTGG + Intronic
1039878694 8:41609704-41609726 TCGTCGAAGTGGTAGTAGTAAGG + Exonic
1040392087 8:46958908-46958930 ATGTGGAGGTGGAAGTCGTGGGG - Intergenic
1041544674 8:59029236-59029258 TTGTGGCAGTGGAAGTCATGGGG - Intronic
1042119752 8:65473907-65473929 ATGTAAAAGTGGAAGTTGAGGGG - Intergenic
1046184183 8:110691251-110691273 TTGTAAATGAGGAAGTTGTGTGG - Intergenic
1051218031 9:14819943-14819965 TTTTAGAAATGGAAGTAGTGTGG + Intronic
1056457121 9:86771464-86771486 AAGGAGAAGTGGAAGTTGTGGGG + Intergenic
1059607476 9:115849804-115849826 TTGTTGGTGTGGATGTTGTGGGG + Intergenic
1060768713 9:126314664-126314686 TTGGCCAAGCGGAAGTGGTGGGG - Intergenic
1188127904 X:26393363-26393385 GTGTTGAAGTAGATGTTGTGTGG - Intergenic
1189131186 X:38499505-38499527 ATGACCAAGTGGAAGTTATGAGG - Intronic
1192332306 X:70185822-70185844 TTGTCAAAGAGGAATTTCTGTGG - Intronic
1201062336 Y:10058799-10058821 TTGTGGAAGTAAATGTTGTGAGG - Intergenic