ID: 907089017

View in Genome Browser
Species Human (GRCh38)
Location 1:51707332-51707354
Sequence GCACCAGAGGGCCCCCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907089017_907089026 25 Left 907089017 1:51707332-51707354 CCCTTTAGGGGGCCCTCTGGTGC 0: 1
1: 0
2: 3
3: 12
4: 80
Right 907089026 1:51707380-51707402 TCGTATTTGGCAGGGTTTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 113
907089017_907089025 17 Left 907089017 1:51707332-51707354 CCCTTTAGGGGGCCCTCTGGTGC 0: 1
1: 0
2: 3
3: 12
4: 80
Right 907089025 1:51707372-51707394 TAATGTCATCGTATTTGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 130
907089017_907089024 16 Left 907089017 1:51707332-51707354 CCCTTTAGGGGGCCCTCTGGTGC 0: 1
1: 0
2: 3
3: 12
4: 80
Right 907089024 1:51707371-51707393 TTAATGTCATCGTATTTGGCAGG 0: 1
1: 1
2: 12
3: 19
4: 108
907089017_907089023 12 Left 907089017 1:51707332-51707354 CCCTTTAGGGGGCCCTCTGGTGC 0: 1
1: 0
2: 3
3: 12
4: 80
Right 907089023 1:51707367-51707389 CTTCTTAATGTCATCGTATTTGG 0: 1
1: 1
2: 13
3: 58
4: 368
907089017_907089027 29 Left 907089017 1:51707332-51707354 CCCTTTAGGGGGCCCTCTGGTGC 0: 1
1: 0
2: 3
3: 12
4: 80
Right 907089027 1:51707384-51707406 ATTTGGCAGGGTTTTCTGGATGG 0: 1
1: 0
2: 10
3: 98
4: 1197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907089017 Original CRISPR GCACCAGAGGGCCCCCTAAA GGG (reversed) Intronic
900994444 1:6112846-6112868 GGTCCAGAGGGCACCCTCAAGGG + Intronic
901443726 1:9294387-9294409 GAACCAGAGGGCCCCCTGGATGG - Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
903337402 1:22634387-22634409 GAACCACAGGGCCCCGAAAAGGG + Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913510688 1:119558944-119558966 GCATCAGAGGGTCCCCATAAGGG - Intergenic
913514906 1:119596360-119596382 GCATCAGAAGGCCCCCATAAGGG - Intergenic
916999159 1:170337270-170337292 GCTCCTGAGGGTCCCCAAAAAGG + Intergenic
921957994 1:221003831-221003853 GCAAAAGAGGGCACCCTAAAGGG - Intergenic
922794989 1:228335453-228335475 GCACCAGGGAGACCCCAAAATGG + Intronic
923357678 1:233176668-233176690 CCACCTGAGGGCCACCTAAGTGG + Intronic
1067214974 10:44293833-44293855 CCACCTGAGGGCCCCCTGAAAGG + Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1069116690 10:64515949-64515971 GGATCAGAGGGCCCTCTAAGGGG + Intergenic
1069170711 10:65225379-65225401 CCACCAGAGAGCCCCCAAACGGG + Intergenic
1069710762 10:70487009-70487031 TCCCCAGAGGGCTCCCCAAAGGG - Intronic
1071524657 10:86351454-86351476 GCAGCACAGGCCCCCCTACAAGG + Intronic
1071763972 10:88641045-88641067 TCACCAGAGGGCCACCAAAAAGG - Intergenic
1077109953 11:857973-857995 GCACCAGGGGGACCCACAAACGG - Intronic
1079080143 11:17408279-17408301 GCCCCAGGAAGCCCCCTAAAGGG - Intronic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1094871936 12:34603653-34603675 GCAGCAGAGGCCCCCCCAACAGG + Intergenic
1103739384 12:123081193-123081215 GCTCCAGAGGCACCTCTAAAAGG + Intronic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1112251384 13:97783780-97783802 ACAACAGAGAGCCCCCAAAAGGG + Intergenic
1112695316 13:101941555-101941577 GCAGCAGAGGGCCCAGGAAATGG - Intronic
1118738550 14:68720994-68721016 GCTCCAGGGGGCCCCATCAAGGG + Intronic
1121174872 14:91883490-91883512 GCCCTAGAGGGCCCTCTGAAGGG + Intronic
1121407139 14:93725976-93725998 GCCACAGAGGGCTCCCTAGATGG + Intronic
1122644932 14:103188028-103188050 ACACCAGAGGCTCCCCTAGAAGG + Intergenic
1139301988 16:65953182-65953204 GCACAAGAGGGCTGCCTATAAGG - Intergenic
1139550485 16:67670099-67670121 TAGCCAGAGGGCCCCTTAAAAGG + Intergenic
1141436392 16:84002105-84002127 GCACCAGAGCACCCCCTCCACGG + Intronic
1144390058 17:14784896-14784918 GAACCACAGAGCCCCCAAAAGGG - Intergenic
1145797618 17:27664930-27664952 TCTCCAGAGGGCCTCCTAATAGG + Intergenic
1147917607 17:43898138-43898160 GCACAAGAGGCCCCCCTGAAGGG - Intronic
1152372414 17:79897592-79897614 GCTCCAAAGGGCCCCGTACACGG - Intergenic
1160196141 18:76757136-76757158 GCACCGCGGGGCCCCCTAAGCGG - Intergenic
1164460188 19:28440362-28440384 GCACCAGAGGTCACCCTTTAGGG - Intergenic
1165783015 19:38444684-38444706 GCCCCAGACCTCCCCCTAAATGG + Intronic
1165921106 19:39298275-39298297 GCTCCAGGAGGCCCCCAAAAAGG + Exonic
1167334216 19:48874652-48874674 GGACCAGAGGGCCCACTTCAGGG + Exonic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
927465766 2:23335456-23335478 GAACAAGAGTACCCCCTAAAAGG + Intergenic
935525697 2:104163730-104163752 CCACCACAGGGGCCCCAAAATGG + Intergenic
937326501 2:120992807-120992829 CCATCAGAGGGCCCACCAAAGGG - Intergenic
939992483 2:148888406-148888428 CCACCACAGGGCCCCCTAATGGG - Intronic
946394181 2:219435033-219435055 GCCCCGGAGTGCCCCCGAAAAGG + Exonic
948538234 2:238663939-238663961 GCCCCAGAGGACCACCTGAACGG - Intergenic
1168889338 20:1284117-1284139 GCACCAGAGGGTCCCCTCTAAGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172208596 20:33181892-33181914 GCTCCAGTGGGACCCCTAGAGGG - Intergenic
1173924620 20:46771548-46771570 GCTCCAGAGGGCACCTTGAATGG - Intergenic
1178671390 21:34594596-34594618 GGGCCTGAGGGTCCCCTAAATGG - Intronic
1179575132 21:42303267-42303289 GCACATTAGGGCCCCCTAAGAGG - Intergenic
1185171971 22:49299506-49299528 GCTCCAGAGGGCACCCTATGGGG - Intergenic
951962995 3:28349247-28349269 GCACCAGAGGGCGCCCCTGAAGG - Intronic
961760389 3:129162865-129162887 CAACCAGAGGGCTCCCCAAATGG - Intergenic
962450213 3:135507315-135507337 GCACCAGAGGGAACCCTACATGG - Intergenic
962499492 3:135975375-135975397 CCACCAGAGGGCCCACATAAAGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
973140466 4:46761277-46761299 GTAGCAGGGGGCCACCTAAATGG + Intronic
976464976 4:85356899-85356921 GCACTACAGGGACCACTAAAAGG - Intergenic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
992786336 5:80173839-80173861 GCACCAGAGGGCCTTAAAAAGGG - Intronic
998036170 5:138918717-138918739 GCAACAGAGGTCCCGTTAAATGG - Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1016303018 6:142652732-142652754 GCAGCAGAGAGTCCCCTGAATGG - Intergenic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1019856761 7:3616488-3616510 CCACCAGAGGGCCTGCTTAACGG + Intronic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1023648267 7:42341959-42341981 GGGACAGAGGGCCCCCAAAAGGG + Intergenic
1028390392 7:90310059-90310081 CCACCAGAGGGCACCTAAAAAGG - Exonic
1033306620 7:140230421-140230443 GGACCCGAGGGCCCACAAAAGGG - Intergenic
1034172378 7:149072138-149072160 GCACCAGAGAGGCCACTCAAAGG - Exonic
1034279711 7:149844533-149844555 CCACCTGAGGGCACCCTACACGG - Intronic
1034859501 7:154583436-154583458 GCACCTGAGGACCTCCTAAGTGG - Intronic
1042964571 8:74336921-74336943 GCACTAGAGGGTCCGCTACAGGG - Intronic
1044396834 8:91722433-91722455 GTAATAGAGGGCCCACTAAACGG - Intergenic
1047680506 8:127249536-127249558 GCACTATAGGGCCCACTACAGGG + Intergenic
1048431825 8:134377843-134377865 ACACCAGAATGCCCCCAAAATGG + Intergenic
1048944147 8:139428865-139428887 CCACCTGAGGGTCCCCTAAAAGG - Intergenic
1052366669 9:27619726-27619748 GCAGCAAAGGGCCCCATTAATGG + Intergenic
1052634466 9:31083832-31083854 GCACGAGACAGCCCCCTATATGG + Intergenic
1057859036 9:98625133-98625155 GCAGCAGAGGGCCCCACAAAGGG + Intronic
1062612394 9:137380794-137380816 GCACCAGAAGGCCCCCCCGAGGG + Intronic
1189188031 X:39070701-39070723 GCACCAAAGGGCCTCCTACTAGG - Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189659764 X:43285150-43285172 CCCCCAGATGGCCCACTAAATGG + Intergenic
1197256571 X:124269739-124269761 AAACCATAGGGCCCCATAAATGG + Intronic