ID: 907098011

View in Genome Browser
Species Human (GRCh38)
Location 1:51799570-51799592
Sequence CCTACTTGACAGTTTTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907098011_907098020 20 Left 907098011 1:51799570-51799592 CCAGGGCAAAACTGTCAAGTAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 907098020 1:51799613-51799635 AAAGGGGTAGGTCTGTTCAGAGG 0: 1
1: 0
2: 1
3: 6
4: 96
907098011_907098019 8 Left 907098011 1:51799570-51799592 CCAGGGCAAAACTGTCAAGTAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 907098019 1:51799601-51799623 AGTCATGTGCACAAAGGGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 179
907098011_907098016 3 Left 907098011 1:51799570-51799592 CCAGGGCAAAACTGTCAAGTAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 907098016 1:51799596-51799618 TAGCCAGTCATGTGCACAAAGGG 0: 1
1: 0
2: 2
3: 11
4: 116
907098011_907098017 4 Left 907098011 1:51799570-51799592 CCAGGGCAAAACTGTCAAGTAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 907098017 1:51799597-51799619 AGCCAGTCATGTGCACAAAGGGG 0: 1
1: 1
2: 1
3: 14
4: 160
907098011_907098015 2 Left 907098011 1:51799570-51799592 CCAGGGCAAAACTGTCAAGTAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 907098015 1:51799595-51799617 CTAGCCAGTCATGTGCACAAAGG 0: 1
1: 0
2: 0
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907098011 Original CRISPR CCTACTTGACAGTTTTGCCC TGG (reversed) Intronic
901256665 1:7834647-7834669 CCTACCTCACTGTGTTGCCCAGG + Intronic
904210761 1:28885556-28885578 CCCACCAGACAGTATTGCCCAGG - Intergenic
907098011 1:51799570-51799592 CCTACTTGACAGTTTTGCCCTGG - Intronic
911871839 1:103108592-103108614 CCTGCTTGTCAGTTTCGCCCTGG - Intergenic
913076988 1:115348661-115348683 CCAACTTGACAGTTTTGCAGGGG + Intergenic
916560653 1:165931765-165931787 CCTTCTTGGGAATTTTGCCCTGG + Intergenic
916652355 1:166843927-166843949 CTGACTTCTCAGTTTTGCCCGGG + Intronic
917442972 1:175083177-175083199 CCTACTTTATAGTTTTGCCTAGG + Intronic
917734451 1:177907694-177907716 ACTACTTGACATTTTGGTCCTGG - Intergenic
917971339 1:180210051-180210073 CCTACTGGACAGGCTTGTCCTGG - Intergenic
918003549 1:180520919-180520941 CCTTCCTGACAGATCTGCCCTGG + Intergenic
918355488 1:183703741-183703763 TCTACTTGCCAATCTTGCCCAGG + Intronic
922432823 1:225572357-225572379 CCTACTTGACAGGTATGCGATGG + Intronic
922965291 1:229685445-229685467 TCTACTTGACAGTGTTCCACAGG + Intergenic
924564321 1:245183863-245183885 CCTGCTTGGCAGCTGTGCCCTGG - Intronic
1063032450 10:2249391-2249413 CGTTCCTGACAGTTTTTCCCAGG + Intergenic
1064004174 10:11687302-11687324 TCTGCTTTACAGTTTGGCCCTGG - Intergenic
1067926445 10:50513280-50513302 CCTACTTCGCTGTTTTTCCCAGG - Intronic
1068173701 10:53428446-53428468 ACTACTTTACAGTTGTGTCCAGG - Intergenic
1068656993 10:59586075-59586097 CTGACTTCACAGTTTTGCCTTGG + Intergenic
1068944942 10:62720274-62720296 CCTACATGACATTTCTGCCTGGG + Intergenic
1069940533 10:71952317-71952339 TCTACTTGCCAGTCCTGCCCTGG + Intergenic
1071870898 10:89793348-89793370 TGTACTTGACAGTTTGGCCTAGG + Intergenic
1072124763 10:92435878-92435900 ACCACTTCACAGTTTGGCCCAGG - Intergenic
1072198160 10:93134807-93134829 CTCACCTGGCAGTTTTGCCCAGG - Intergenic
1072553472 10:96496521-96496543 CCTACTTGACAGATGAGCCAAGG + Intronic
1074547048 10:114409194-114409216 CCAACTGGACAGTTTCACCCCGG + Intergenic
1080676119 11:34428875-34428897 CCTACATCACCGTTTTGCCTTGG - Intergenic
1081204989 11:40264685-40264707 TCTTCTTGGCAGTTTTTCCCAGG - Intronic
1087048568 11:93864861-93864883 TCTACTTGCCAATCTTGCCCAGG + Intergenic
1088817408 11:113431203-113431225 GCTACTTGACAGTGTTTCCTGGG + Intronic
1089613368 11:119681802-119681824 CGTCCTGGACATTTTTGCCCTGG + Intronic
1090071426 11:123547686-123547708 GTTACTTTACAGTTTTGCACAGG + Intronic
1091700100 12:2653566-2653588 CGTTCTTGATTGTTTTGCCCAGG + Intronic
1092855726 12:12672074-12672096 CCTCCTTGACAGTTTTGTGAAGG + Intronic
1093193940 12:16107974-16107996 CCTACTTAAGAATTTTGCCAAGG + Intergenic
1093213408 12:16334205-16334227 CCTACTTCATGGTTTTGCCTAGG + Intergenic
1093687422 12:22072447-22072469 GCTACTTATCAGTTTAGCCCCGG - Intronic
1095883590 12:47165060-47165082 ACTGCTTGAGAGTTTTACCCTGG + Intronic
1096373513 12:51088367-51088389 CTTACTTGAAATTTTTGGCCAGG + Intergenic
1096839317 12:54370822-54370844 CCTTCTTCAGAGTTTTCCCCAGG - Intronic
1097960528 12:65527893-65527915 CCTACTACACAGTTTTGCAATGG + Intergenic
1100126703 12:91436069-91436091 ACTATTTCACAATTTTGCCCAGG + Intergenic
1100719052 12:97337630-97337652 GCTACTTGACATTTTTGCTTTGG - Intergenic
1100801715 12:98238731-98238753 CCTACTTTACAAATTTGCCTAGG - Intergenic
1101201819 12:102444260-102444282 TCTACCTAACAGTTTTGTCCAGG + Intronic
1102651154 12:114443563-114443585 GATAATTGACAGTTTTGCCTAGG + Intergenic
1104588610 12:130066976-130066998 CCTCCTTTACAGTTTTGGCAGGG - Intergenic
1105637793 13:22232155-22232177 GCTATTTGACAGTGTTGCACAGG - Intergenic
1108090431 13:46843697-46843719 CTTACTTTTCATTTTTGCCCTGG + Intronic
1108269520 13:48745921-48745943 CCTACTTCATAGTATTGCCAAGG + Intergenic
1108740477 13:53332255-53332277 CCTACTTTACAATTTTGCCTAGG + Intergenic
1109874104 13:68375931-68375953 CACACTTCACAGTTTTGGCCAGG + Intergenic
1112063683 13:95768529-95768551 CCTCTTTCACAATTTTGCCCAGG - Intronic
1114651449 14:24287248-24287270 CCTCCTGGACTGCTTTGCCCTGG + Intergenic
1114988939 14:28263629-28263651 CCTCCATGACAATTTTGCCATGG + Intergenic
1117146465 14:52841074-52841096 CCTACTTCACAGCTGTGCCAGGG + Intergenic
1118234878 14:63993142-63993164 TCAACTTCAAAGTTTTGCCCAGG - Intronic
1118510267 14:66464365-66464387 CCTACTGTGCAGTTTTGCCTAGG - Intergenic
1120301803 14:82716769-82716791 CCTGCTTTACAGATTTGCCAAGG + Intergenic
1121735238 14:96213786-96213808 CCTACTTGGCAGGTTTGTCGGGG - Intronic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1125183267 15:36901779-36901801 CTTACTTGATAATTTTGTCCAGG - Intronic
1125814998 15:42576278-42576300 CCTACTTAACAGTTCCGTCCTGG - Intronic
1127333333 15:57959794-57959816 CCTACTTTATAGTTTTGCTTGGG + Intronic
1127821508 15:62660504-62660526 TCTACATGACAGTTTTCCTCAGG + Intronic
1129962431 15:79699379-79699401 CCAACTAGACAGTTTTGTCAGGG + Intergenic
1130997486 15:88912059-88912081 CCCACTGGACCGTTTTGCCCTGG - Intronic
1133929118 16:10217873-10217895 CCTAGTTGACAAGTTTCCCCAGG + Intergenic
1136867695 16:33770030-33770052 CCTCCCTGACAGATCTGCCCAGG + Intergenic
1137269793 16:46895722-46895744 GCAACTTGAAAGTGTTGCCCAGG + Intronic
1137494551 16:48959694-48959716 GCTACTTGACAGATTTCTCCAGG - Intergenic
1138397388 16:56715888-56715910 GGTACTTGACAGCTTTGCACTGG + Intronic
1140842021 16:78848640-78848662 CCTAATTAACAGATTTGCCTAGG + Intronic
1142007069 16:87694408-87694430 CCTGCTTGACCGTCTGGCCCGGG - Intronic
1144960147 17:19040164-19040186 CCTCCCTGACAGCTTGGCCCAGG + Intronic
1144975013 17:19134360-19134382 CCTCCCTGACAGCTTGGCCCAGG - Intronic
1147688607 17:42301545-42301567 CCTAGTTCACCGTGTTGCCCAGG + Intronic
1152342290 17:79731750-79731772 CCTCCCTGACAGATCTGCCCAGG + Intronic
1152654681 17:81514203-81514225 CATACCTGACAGCCTTGCCCGGG - Intronic
1155395202 18:25379779-25379801 CCTACTTGGCCATCTTGCCCAGG - Intergenic
1155498557 18:26465443-26465465 ACTACTTGACAGTTCTCACCAGG + Intronic
1155657718 18:28210811-28210833 TCTACTTGCCAATCTTGCCCAGG + Intergenic
1157268839 18:46253546-46253568 CTTATTTGACAGTTTTGCTGTGG + Intronic
1157532202 18:48430442-48430464 CCTGCTGCACAGTTTTGCCCAGG - Intergenic
1159761817 18:72436142-72436164 CATACTTCACAGTTTTGCCTCGG - Intergenic
1159882527 18:73872444-73872466 CTTACTTAAAAGTTTTGCCTTGG + Intergenic
1160040799 18:75343777-75343799 TCTGAATGACAGTTTTGCCCTGG - Intergenic
1163485225 19:17581411-17581433 CCCACTGGACAGTGCTGCCCGGG + Exonic
1168162766 19:54522898-54522920 CCTCCTTGTCCATTTTGCCCAGG + Intergenic
931845027 2:66194400-66194422 TCTACTCAACAGTTTTGCCTGGG - Intergenic
931854313 2:66285728-66285750 CCCACTGGAAAGTTTTGCCAAGG - Intergenic
932456228 2:71851651-71851673 TCTACTAGAGAGTTCTGCCCTGG - Intergenic
933185796 2:79278133-79278155 CCTACTTCACTGTATGGCCCTGG + Intronic
933233003 2:79830523-79830545 TCTACTTCACAGTGTTGCCCAGG + Intronic
933775932 2:85771181-85771203 CCTACTTCACAGTTTTGCTGAGG - Intronic
934632826 2:95948565-95948587 CCTACTGGACCGTTTTGCACAGG - Exonic
936099115 2:109559737-109559759 CCTACTGGACATTCTTTCCCTGG + Intronic
936679052 2:114750159-114750181 CCTTCATGACATTTTTGCCTTGG - Intronic
942473546 2:176289451-176289473 CCTACTTCCCAATTTTGCCCAGG - Intronic
943065836 2:183085207-183085229 CTTACTTTACACTTTTCCCCAGG - Intronic
943129858 2:183841542-183841564 CCTATTTGGCAATCTTGCCCAGG - Intergenic
945935887 2:215902274-215902296 GCTACTTCACAGTTTCACCCAGG + Intergenic
946058571 2:216921584-216921606 CTTACTTCACAGTTCTCCCCAGG + Intergenic
946351509 2:219157869-219157891 CCTACTTCACAATTCTGCCTTGG + Intronic
1169984212 20:11423557-11423579 CCTATTTGGCCTTTTTGCCCAGG + Intergenic
1170335392 20:15265082-15265104 CCTATTTCACAGTTTTCTCCAGG - Intronic
1171564620 20:26169494-26169516 CCTAATTACCAATTTTGCCCTGG - Intergenic
1172600958 20:36182645-36182667 CCTACATGACAGTGATGGCCCGG - Intronic
950722872 3:14897434-14897456 CCTCCTTGGCAGATTTCCCCTGG - Intronic
952090596 3:29880800-29880822 CCTACTTCACGATTTTGCCTAGG - Intronic
954557930 3:51532943-51532965 TCTACTTGCCAATCTTGCCCGGG + Intergenic
954973556 3:54672074-54672096 CCTGCTTGAGATTTTTGCTCTGG + Intronic
955705953 3:61727896-61727918 TCTACTTTACAGTTTTGCTTTGG + Intronic
963027337 3:140933087-140933109 CCTATTTGGCCATTTTGCCCGGG - Intergenic
963959888 3:151297682-151297704 CCTACTTCACAGTGTTGCTTAGG + Intronic
965872675 3:173279930-173279952 TCTACTTGCCAATCTTGCCCGGG - Intergenic
966616781 3:181921872-181921894 CCTTCTTCACAGTTTTGCCTTGG - Intergenic
966834350 3:184037916-184037938 CTTACTAGACAGTTTGGCCTGGG + Intronic
967083677 3:186074288-186074310 CACATTTTACAGTTTTGCCCTGG - Intronic
971986522 4:33832076-33832098 CCTAATTACCAATTTTGCCCTGG + Intergenic
973747307 4:53976603-53976625 CATACTTGCCAGTTTAACCCAGG + Intronic
975214907 4:71742196-71742218 ACTGGTTGACAGTTTTGCCTTGG - Intronic
976299655 4:83506087-83506109 TCTACTTGCCAATCTTGCCCAGG + Intronic
979209994 4:118088795-118088817 CTTTCTTGACAGTTATGCCTTGG + Intronic
981246037 4:142539636-142539658 CCTACTCAACAGTTTTTCACAGG - Intronic
982086836 4:151844183-151844205 CCTACTTTGCAGTTTTACCTAGG - Intergenic
983279998 4:165668487-165668509 CATATTTAACAGTTTTACCCAGG + Intergenic
984695081 4:182770948-182770970 CCAGCTTAACAGTTTAGCCCTGG - Intronic
984757153 4:183335743-183335765 AATACTTGACAGCTTTGGCCTGG + Intergenic
989144740 5:38237571-38237593 CCTTCTTGACAATTTTGCAAAGG + Intergenic
989189699 5:38658842-38658864 ACTAATTGACTGTTTTTCCCAGG + Intergenic
989525209 5:42445871-42445893 GCTACTGGACAGTTATTCCCTGG - Intronic
990122031 5:52466726-52466748 TCTACTTCACAGTTTTGCTTAGG - Intergenic
990303303 5:54470869-54470891 CCTCCTTGACATTTCAGCCCAGG + Intergenic
994925315 5:106110289-106110311 CCTACTTAACTGGTTTGCCCTGG - Intergenic
996443742 5:123519894-123519916 TCTACTTTACAGTTTTGCTCAGG + Intronic
996797958 5:127371275-127371297 CCTGCAAGACAGTTTTCCCCTGG - Intronic
996823240 5:127653837-127653859 ACTAATTCACAATTTTGCCCAGG - Intronic
997711522 5:136008723-136008745 CCTCCATGCCAGTTGTGCCCTGG - Intergenic
998738356 5:145169504-145169526 CTTACTTAACAGTTTTTCCAAGG - Intergenic
998973489 5:147618439-147618461 TCTACTTGACAGCTCTGGCCAGG + Intronic
1000901014 5:166911911-166911933 CCAAATTGACAATTTTGCCTAGG - Intergenic
1003990626 6:11482983-11483005 CATACTTGTAAGTTTTGCTCTGG - Intergenic
1004027881 6:11836891-11836913 CCTATTTGACCATTTTGCCCAGG - Intergenic
1008938479 6:57019236-57019258 TCCACTTCACAGTTTTGCCTGGG - Intronic
1009318986 6:62261310-62261332 ACTACTTAACAGTTCTGCACTGG + Intronic
1009480709 6:64155140-64155162 CCTGCTTTACAATTTTGCCTTGG + Intronic
1009853612 6:69231070-69231092 CTTACTTCCCAGTTTTGCCTGGG + Intronic
1010114525 6:72286796-72286818 CATACTACACAGTTTTGCACTGG + Intronic
1014147007 6:118009560-118009582 GCAAGTGGACAGTTTTGCCCAGG + Intronic
1014837159 6:126172554-126172576 CCTACTTCACACTTTTGACCAGG - Intergenic
1017015875 6:150099073-150099095 TCTACTTGCCAATCTTGCCCGGG - Intergenic
1018102523 6:160453857-160453879 CATACTTTACAGTGATGCCCAGG - Intergenic
1020506429 7:8994623-8994645 CCTACTTTTTAGTTTTGTCCAGG + Intergenic
1020544875 7:9514713-9514735 CTTTCTTGACAGTTTTCCCCAGG + Intergenic
1020774390 7:12435107-12435129 CCAACTTCACAGATTTGCTCAGG - Intergenic
1022003735 7:26248549-26248571 TCTACTTGCCAATCTTGCCCGGG - Intergenic
1024225845 7:47326457-47326479 CCTTCTGCACAGGTTTGCCCTGG + Intronic
1025273166 7:57545041-57545063 CCTAATTATCAATTTTGCCCTGG + Intergenic
1027520571 7:79201262-79201284 CTTACTTCACAGTTTTGCCTAGG + Intronic
1027928372 7:84497484-84497506 CCAACTTTACAATTTTGCCTTGG + Intergenic
1028123585 7:87085634-87085656 TCTGCTTCACAATTTTGCCCTGG + Intergenic
1034694094 7:153038851-153038873 CCTAGTGGGCAGTTTTGGCCAGG - Intergenic
1035904995 8:3499933-3499955 CCCACATGACTGTTTTGCTCCGG - Intronic
1036612382 8:10361448-10361470 CCTATTTCAAAATTTTGCCCAGG - Intronic
1038349303 8:26761934-26761956 CCTGGTTGACAGTTTTGCTTAGG + Intronic
1041262135 8:56030675-56030697 ATTAGTTGACATTTTTGCCCTGG + Intergenic
1042158476 8:65868471-65868493 TCTACTTGCCAATCTTGCCCAGG - Intergenic
1043592663 8:81848233-81848255 TCTAATTGACAGTGTTCCCCTGG - Intergenic
1044774241 8:95671092-95671114 GCTACTTGGCAGTTTTGCTTAGG - Intergenic
1044919177 8:97149621-97149643 TCTACATGACAGTTAGGCCCAGG - Intronic
1045390476 8:101709977-101709999 CCTATTTGGCTGTCTTGCCCAGG - Intronic
1046382871 8:113473597-113473619 TCTACTTGCCAGTCTTCCCCTGG + Intergenic
1048717711 8:137286609-137286631 TCTACTTGCCAATCTTGCCCAGG - Intergenic
1050234504 9:3563319-3563341 CCTAATTGGCTGTGTTGCCCAGG + Intergenic
1051679788 9:19595495-19595517 ACAATTTGACAGTTTTGCTCAGG + Intronic
1053439830 9:38107136-38107158 CCTCCCTCACAGTTTTGGCCGGG + Intergenic
1054924949 9:70579789-70579811 CCTACATGGCAGTTTTGTCAAGG - Intronic
1056114118 9:83425489-83425511 CCTGCTGGACAGGTTTCCCCGGG - Intronic
1057060064 9:91995839-91995861 CCTGTTTGATCGTTTTGCCCTGG - Intergenic
1059323623 9:113488308-113488330 CCTACTTCACAGCTCTGACCTGG - Intronic
1060617040 9:125026438-125026460 CCTACATGACAGTTGTCACCAGG + Intronic
1187335231 X:18375894-18375916 CCTACTTAGCATTTTTGGCCAGG - Intergenic
1192282197 X:69699018-69699040 TCTACTTGCCAATCTTGCCCGGG + Intronic
1193850178 X:86528188-86528210 CCTACTTCTCAGTTTTGCTTAGG + Intronic
1194125254 X:90008606-90008628 CATCATTGATAGTTTTGCCCAGG + Intergenic
1194618232 X:96134590-96134612 CTTACTTCACAATTTTGCCTTGG - Intergenic
1195704761 X:107730766-107730788 CCTACTTCACAGTTTACCCTGGG - Intronic
1195914883 X:109926394-109926416 CCTACTTTACAGATTAGCCATGG - Intergenic
1196108431 X:111920345-111920367 CATATGTCACAGTTTTGCCCAGG - Intronic
1198158979 X:133988172-133988194 CCTACTTCATAATTTTGCCTGGG + Intergenic
1199305592 X:146263951-146263973 CCTACATGACAGTGTGTCCCTGG - Intergenic
1199710380 X:150464988-150465010 CCTTTTTGACAATTTTGCCCAGG + Intronic
1201793734 Y:17871776-17871798 CCTATTAGACAGCTTAGCCCAGG - Intergenic
1201807820 Y:18034210-18034232 CCTATTAGACAGCTTAGCCCAGG + Intergenic
1202355119 Y:24039594-24039616 CCTATTAGACAGCTTAGCCCAGG - Intergenic
1202515659 Y:25630515-25630537 CCTATTAGACAGCTTAGCCCAGG + Intergenic