ID: 907100374

View in Genome Browser
Species Human (GRCh38)
Location 1:51828101-51828123
Sequence ACATATAAACTACACCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907100374 Original CRISPR ACATATAAACTACACCTGAG TGG Intronic
901937599 1:12637192-12637214 ACACAGAAAGTACAACTGAGGGG - Intergenic
902162573 1:14543199-14543221 ACATATAATCTACATCCTAGGGG + Intergenic
905097667 1:35487881-35487903 ACCTCTAAACTACACCTGCATGG - Intronic
907100374 1:51828101-51828123 ACATATAAACTACACCTGAGTGG + Intronic
910036633 1:82796750-82796772 GGATATAGACTACACTTGAGTGG - Intergenic
910869472 1:91819474-91819496 ACATAGAAATTACAACTCAGAGG + Intronic
911336121 1:96582661-96582683 GCTTATAAACTAAACCTGAATGG + Intergenic
913071601 1:115303887-115303909 CCATATAACCTCCAACTGAGTGG + Intronic
914228327 1:145741260-145741282 ACATACAAACTACACTTCTGTGG + Exonic
918071670 1:181137730-181137752 AGATTTAAACTACACCTGACAGG - Intergenic
918527087 1:185476783-185476805 TCATATAATCTACATCTGAGAGG - Intergenic
919609066 1:199722527-199722549 ACACACAAAATATACCTGAGTGG + Intergenic
921566046 1:216721796-216721818 ACCTTCAAACTACACTTGAGCGG + Intronic
923703408 1:236321716-236321738 ATTTAAAAACTACAGCTGAGGGG + Intergenic
1063220218 10:3960340-3960362 ACAGTTAAACTACTCCTGAGAGG + Intergenic
1065547865 10:26840078-26840100 ACATCTAAACTACAGCAGTGAGG - Intronic
1065620986 10:27580719-27580741 ATATCTAAACTACATCAGAGGGG + Intergenic
1066228292 10:33406553-33406575 ACTTATGAACTAAATCTGAGAGG + Intergenic
1066240484 10:33529498-33529520 ATATATACACTACACCAAAGAGG + Intergenic
1072811937 10:98468579-98468601 ACAGATAAAATAAGCCTGAGAGG - Intronic
1081016965 11:37893754-37893776 ACATTTAAACTAAACATGAAAGG + Intergenic
1081826341 11:46057084-46057106 ATATAAAAACTACAATTGAGAGG + Intronic
1084109131 11:67002193-67002215 ATACATAAACAACACCTGAAAGG + Intergenic
1090350022 11:126101866-126101888 CCATATAACATACACCTGGGTGG + Intergenic
1093084256 12:14849099-14849121 ACAAAGAAGCTACAGCTGAGTGG - Intronic
1099711212 12:86226942-86226964 AAATATAAACTACAAGTTAGAGG - Intronic
1101179482 12:102198354-102198376 AGAGATAAAATACACCTGACAGG - Intergenic
1104228829 12:126863661-126863683 GCATATAAAAAACATCTGAGAGG - Intergenic
1105977933 13:25489819-25489841 ATATATAAACTACTCCTAAAAGG + Intronic
1120412653 14:84176629-84176651 AGATGTAAACTACAGCTGAATGG + Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1130994577 15:88896780-88896802 ACAGGTAAACTACACCTAAAAGG + Intergenic
1132173043 15:99683299-99683321 ACATATGAATTAAAACTGAGTGG + Intronic
1134377394 16:13690253-13690275 ACATATAGACTACCCTTGAAAGG + Intergenic
1136361651 16:29784379-29784401 ACATAGAAAGTACACCTGAGTGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143238419 17:5422893-5422915 ACTTATAAACTAATCCTGATTGG - Intronic
1146536351 17:33656087-33656109 CCCTAGAAACTAAACCTGAGAGG + Intronic
1148660412 17:49326585-49326607 ACATGTGAACTACTCCTCAGGGG + Intronic
1153055924 18:946176-946198 AAATATAAAATAACCCTGAGTGG - Intergenic
1153095447 18:1396616-1396638 AAATATAAAACACACGTGAGAGG - Intergenic
1153428171 18:4988697-4988719 TCTTCTCAACTACACCTGAGGGG + Intergenic
1157414045 18:47487436-47487458 ACATATCAACTACGCCTGATGGG - Intergenic
1158858623 18:61569972-61569994 ATATATTAACTACACCCAAGAGG + Intergenic
1160089083 18:75808967-75808989 AGATATAAAATACTCCTGATTGG - Intergenic
1162870270 19:13581149-13581171 ACATTTAAGGTACGCCTGAGAGG + Intronic
1164583662 19:29451439-29451461 ACATATAACCCAATCCTGAGTGG - Intergenic
1167632121 19:50631839-50631861 TGATATAAACTAGGCCTGAGAGG - Intronic
1167986467 19:53322291-53322313 AAATAAAAAATACACTTGAGAGG - Intergenic
925108838 2:1316414-1316436 ACACATAAAGTACAGCTCAGAGG + Intronic
926263333 2:11288976-11288998 AAATATGAACTATAACTGAGTGG - Intronic
927397513 2:22670791-22670813 ACATTTAAACTGCACTTAAGAGG - Intergenic
929744765 2:44645351-44645373 ACATACAAACCACAGCGGAGAGG + Intronic
937712569 2:124995240-124995262 AAATATAAACCACACCTGAATGG + Intergenic
938883682 2:135619633-135619655 ATAAATAAATTGCACCTGAGTGG + Intronic
939383593 2:141467152-141467174 AGATATTTAATACACCTGAGAGG - Intronic
943286123 2:186003354-186003376 AAAAATAAACTAAAACTGAGTGG - Intergenic
943952648 2:194150155-194150177 ACATATAAACTAACAGTGAGGGG - Intergenic
948920192 2:241062710-241062732 GCACATAAACTAGTCCTGAGGGG - Intronic
1170533550 20:17317797-17317819 ACACATAAACAACACATGAAAGG + Intronic
1173756316 20:45519670-45519692 CCATATAAACAAAAACTGAGAGG - Intergenic
1175264764 20:57695894-57695916 ACACATTAACACCACCTGAGGGG - Intronic
1181745985 22:24955193-24955215 ACATATAAAATATCCCTGTGAGG - Intronic
1184728730 22:46361425-46361447 ACAAAAAAATTACACCTCAGGGG + Exonic
950877590 3:16290341-16290363 ACATAAAAACTTCATCTGAATGG - Intronic
951416222 3:22425209-22425231 ACATACAAAATAGACCTGACAGG - Intergenic
960793505 3:121458896-121458918 ACACAAAAACTACAACTGTGAGG + Intronic
965765815 3:172128864-172128886 AGATATAAACCATACCAGAGAGG - Intronic
968123092 3:196140203-196140225 TCCTATAAAATATACCTGAGGGG + Intergenic
970545791 4:17128781-17128803 ACATATGAACTAAAGCTCAGAGG - Intergenic
970908624 4:21247763-21247785 ATATATAAAAAACACCTGTGGGG - Intronic
976544195 4:86315080-86315102 ACACATAAAATACATTTGAGAGG + Intronic
977249234 4:94670875-94670897 GAATATAAATTACAGCTGAGGGG + Intergenic
978827341 4:113041304-113041326 ACATTTAAATTAAACCAGAGTGG - Intronic
981206198 4:142043351-142043373 AAATATAAAATATACCAGAGAGG + Intronic
981362122 4:143859204-143859226 AAATAAAAACTACATGTGAGGGG - Intergenic
981372858 4:143980041-143980063 AAATAAAAACTACATGTGAGGGG - Intergenic
981381947 4:144083281-144083303 AAATAAAAACTACATGTGAGGGG - Intergenic
981515802 4:145608375-145608397 ACATATAAACTACGCCAGAATGG + Intergenic
983850821 4:172578569-172578591 TCATATAAACAACACCCAAGAGG - Intronic
985287820 4:188354797-188354819 ACATAAAAACTACATCAGACAGG - Intergenic
986595892 5:9421345-9421367 ACATATAATCTATACTTGATTGG + Intronic
987139879 5:14934235-14934257 AAATATAAGCAACAACTGAGGGG - Intergenic
987923150 5:24309334-24309356 GCAGCTAAACAACACCTGAGAGG - Intergenic
989864561 5:46433342-46433364 ACATACAAACTAGACATGATGGG - Intergenic
989948079 5:50263126-50263148 ACATAAAAACTAGACAGGAGAGG - Intergenic
996697338 5:126412870-126412892 ACATATAAACTAAACTCTAGAGG - Intronic
1000056680 5:157613197-157613219 ACATATAAAATAGAGCAGAGAGG + Intergenic
1002381902 5:178837026-178837048 AAATATAAACTGCTCCTGACTGG - Intergenic
1003694855 6:8394235-8394257 ACTTATAAACTACATATGAAAGG - Intergenic
1005753115 6:28902083-28902105 ACAGATAAACTGCAGCAGAGAGG - Intergenic
1009738994 6:67719996-67720018 AAAGATAAAATACATCTGAGAGG + Intergenic
1010150600 6:72727681-72727703 ATATATTACCTAAACCTGAGGGG + Intronic
1014260424 6:119210184-119210206 ACAAATAACCTGCTCCTGAGAGG + Intronic
1020468147 7:8504521-8504543 AGATAGAAACTGCTCCTGAGTGG - Intronic
1022155356 7:27656031-27656053 GAATATATACTACACATGAGGGG + Intronic
1027695044 7:81399924-81399946 ACATTTAGGCTACACCAGAGAGG - Intergenic
1028156201 7:87432416-87432438 ACATATAAATTAAAAATGAGAGG + Intronic
1028898682 7:96071146-96071168 ACATATAAAATGCACCAGGGTGG - Intronic
1031113065 7:117635304-117635326 ACATATAAACTAAAAGTAAGGGG - Intronic
1031885087 7:127238121-127238143 AGGTATAAACGACACCTCAGGGG - Intronic
1036481642 8:9145183-9145205 ACATAGAAACTAGACTTGTGGGG + Intronic
1038481269 8:27903261-27903283 AGATGTAAACTACAGCTGAATGG - Intronic
1041814800 8:61958112-61958134 ACCGATAAACTAAAGCTGAGAGG - Intergenic
1041970479 8:63736069-63736091 ACATATAAACTAGACCAGATAGG - Intergenic
1043111759 8:76193527-76193549 ACATATAAACTACAAATGACTGG + Intergenic
1046616217 8:116480433-116480455 GTATATAAACAAAACCTGAGTGG + Intergenic
1050075654 9:1860386-1860408 ACATATAGACTAAAAGTGAGGGG + Intergenic
1050991234 9:12155030-12155052 AGAAATAAACTAGGCCTGAGAGG + Intergenic
1052480493 9:29019015-29019037 ACCTATAAACGTAACCTGAGAGG + Intergenic
1054857643 9:69918111-69918133 ACATATAAAAAAGACCTGAAAGG + Intergenic
1057493095 9:95537906-95537928 ACATTTAAAGTACCGCTGAGAGG - Intergenic
1187076625 X:15941802-15941824 AGATAAAAACCACAACTGAGTGG - Intergenic
1187330784 X:18337389-18337411 ACATATAAACTACAAGTAAAGGG + Intronic
1187461503 X:19491380-19491402 GCACATAATCCACACCTGAGCGG + Intronic
1189068687 X:37840096-37840118 AAATATTAAGTACAACTGAGGGG + Exonic
1194773410 X:97932640-97932662 ACATATAAACTGGAGCTGAGAGG - Intergenic
1200425093 Y:3011663-3011685 ACATATAAACTCCAGCTAGGAGG - Intergenic