ID: 907100938

View in Genome Browser
Species Human (GRCh38)
Location 1:51834895-51834917
Sequence CACAAACATATGCAGATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907100938 Original CRISPR CACAAACATATGCAGATTAA TGG Intronic
902665921 1:17938129-17938151 CACAAAGACATTCAGCTTAAAGG - Intergenic
903203168 1:21760199-21760221 CACTAACAGTTCCAGATTAAAGG + Intronic
905111915 1:35601427-35601449 CTCAAACCTATGCATATTCATGG + Intronic
905684529 1:39899265-39899287 CACAAACAGGTTCAGGTTAAAGG + Intronic
905950685 1:41948070-41948092 CTCAAACCTATGCTGATTGAGGG + Intronic
905954674 1:41982313-41982335 CACAAACAAAAGCAGTTTAATGG + Intronic
907100938 1:51834895-51834917 CACAAACATATGCAGATTAATGG + Intronic
907650534 1:56290681-56290703 CAGAAACATTTGCATTTTAAAGG - Intergenic
909529638 1:76667887-76667909 CACACACATCTGCAGACTAGGGG + Intergenic
909792241 1:79694032-79694054 GATAAGCATATGCAGATTAAAGG - Intergenic
910550802 1:88472150-88472172 CACAAACATAATTAGATTAAAGG + Intergenic
910878248 1:91898234-91898256 CACACACATATGCGGAAGAAAGG - Intronic
911475718 1:98369800-98369822 CAGAAACCCATGCAGATGAAAGG + Intergenic
911887591 1:103324584-103324606 CACAAACAAAAGGACATTAATGG - Intergenic
911974456 1:104473702-104473724 CACAAACATATACATATGCATGG - Intergenic
913029183 1:114881337-114881359 CACAAACATATTCTCACTAAAGG - Intronic
913114399 1:115683300-115683322 CAGAAACATAGGCAGATTTCAGG - Intronic
913552321 1:119927629-119927651 CACAAGCATTTGCAAAGTAAGGG - Intronic
915688450 1:157661630-157661652 CACAAACAAAAATAGATTAAAGG - Intergenic
917037473 1:170764645-170764667 GACAAACATTTGCTGATGAAAGG + Intergenic
917091048 1:171353606-171353628 CACAAACAAAGGCAGGGTAAAGG - Intergenic
918779857 1:188685521-188685543 CACAAACAGATGCGAGTTAAGGG + Intergenic
919190555 1:194211986-194212008 CACAATCCTATGCGAATTAACGG + Intergenic
920694178 1:208169292-208169314 GATAAACAAGTGCAGATTAACGG + Intronic
921317378 1:213905277-213905299 CACAAGCATAGGCAGATTTGGGG - Intergenic
921772887 1:219063444-219063466 AACAAAGATATACAGATCAATGG + Intergenic
1063372796 10:5532679-5532701 CACAAACATAGAGAGAATAAAGG - Intergenic
1063769344 10:9179965-9179987 AAGAAACATATGTAAATTAAAGG + Intergenic
1064736699 10:18389051-18389073 CACAAACATAGGAACATTACAGG + Intronic
1064980024 10:21157134-21157156 CACAAAGATATGCATGTCAAAGG + Intronic
1068821705 10:61384414-61384436 CCCAAACATTAGCATATTAAAGG - Intergenic
1069123691 10:64602898-64602920 CACATATATATGCAAATGAAAGG + Intergenic
1071226158 10:83530709-83530731 CACAAAAATATGCATAAAAATGG - Intergenic
1071944324 10:90624513-90624535 CTAAAACACATGTAGATTAAAGG + Intergenic
1072533465 10:96341399-96341421 CACATGCATATGCTGATCAATGG + Intergenic
1073761640 10:106635439-106635461 CACAAACACATACAGATTTATGG - Intronic
1074514455 10:114152392-114152414 CAGAAACATATTCTGATTGATGG + Intronic
1074792008 10:116898773-116898795 CACCAACATATGCAAAGCAAGGG - Intronic
1074923422 10:118043247-118043269 CTCAGACATATGCAGATTTTAGG - Intronic
1078124021 11:8540755-8540777 AACAAAGAGATGCAGATCAAAGG + Intronic
1079894143 11:26097668-26097690 TACAAAAATAGGCAGATGAATGG + Intergenic
1080899486 11:36474520-36474542 CACAAAGATAGACAGATCAATGG + Intergenic
1081073446 11:38639476-38639498 CACAAAAATATGCAAAATATAGG - Intergenic
1081341452 11:41932982-41933004 AACAAACACATTCAGGTTAATGG - Intergenic
1082751514 11:57023168-57023190 TTCAAACAAATACAGATTAAAGG + Intergenic
1085925882 11:81020323-81020345 CACAAAAATAGACAGATCAATGG - Intergenic
1085931727 11:81091552-81091574 CACAAAGATATGCATGTTATTGG + Intergenic
1086344528 11:85882807-85882829 CACAAACACATGTAGGTAAATGG + Intronic
1086897538 11:92330686-92330708 GACAAAAATATGCAAATAAATGG + Intergenic
1087394503 11:97580312-97580334 CAAATACATCAGCAGATTAATGG - Intergenic
1088608861 11:111557959-111557981 CACAAACATTTTCAGAGTGAGGG - Intronic
1089394347 11:118126100-118126122 CACACACATATGTACATTCATGG + Intergenic
1089946202 11:122476680-122476702 CACAAACATATACTGATCCAGGG - Intergenic
1091234502 11:134011839-134011861 CACAAACATGCCCAGATTCAGGG + Intergenic
1091470606 12:723281-723303 CACAGGCATAGACAGATTAATGG + Intergenic
1091508535 12:1098031-1098053 CGCAAAGTTTTGCAGATTAATGG + Intronic
1092325588 12:7527922-7527944 CACAAAGCTATGCAGAATCATGG - Intergenic
1094027323 12:25972774-25972796 CACATGCATATGCAGTTTATTGG + Intronic
1094309117 12:29058298-29058320 GACAAACATAAACAAATTAAGGG + Intergenic
1095333252 12:40994590-40994612 TACAAACATATGCAGCTCTAGGG + Intronic
1097949681 12:65413888-65413910 AGCAAACATATGCAGAAGAAAGG + Intronic
1098590673 12:72207913-72207935 CAGAGACAAAAGCAGATTAATGG - Intronic
1098633925 12:72757645-72757667 CCCAAACACATGGAGATTATGGG - Intergenic
1099530037 12:83767260-83767282 CCCAAATATGTGCAGTTTAAAGG - Intergenic
1101757188 12:107630083-107630105 CACAAACATGGACAGATTCAAGG + Intronic
1104197482 12:126554788-126554810 CTCTTTCATATGCAGATTAAAGG + Intergenic
1105653956 13:22413977-22413999 GACAGTCATATACAGATTAATGG - Intergenic
1107599267 13:41996061-41996083 CACAAACACATGCAGAGTCATGG + Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1107874750 13:44780482-44780504 CACAAACATATTCAGGCTGAGGG - Intergenic
1108155699 13:47582844-47582866 CAAAAACAGACACAGATTAATGG + Intergenic
1108239961 13:48453893-48453915 CACAAATAAATACAGATAAAAGG - Intronic
1108667470 13:52647198-52647220 CACAAAAATAGACAGATTAATGG - Intergenic
1108904769 13:55454513-55454535 CACAAACATATTCACTTTTATGG - Intergenic
1108994146 13:56703654-56703676 CAAAAACAGGTGCAGAATAATGG - Intergenic
1109034985 13:57245689-57245711 CAAATACATTTTCAGATTAAAGG + Intergenic
1109816963 13:67597385-67597407 CACTAACATAGGCAGCTTTATGG + Intergenic
1109922464 13:69084825-69084847 CACAAACATATTAAGATATATGG + Intergenic
1110330470 13:74266479-74266501 CACACACATATGCACAGGAATGG + Intergenic
1110405959 13:75150858-75150880 AAGAAATATATACAGATTAAAGG - Intergenic
1110513904 13:76386060-76386082 CACAACCATATAAAGATAAAAGG + Intergenic
1110918466 13:81053764-81053786 CACAAAAACCTGCACATTAATGG + Intergenic
1111716268 13:91883355-91883377 CACAAGCATGTCCAGATTCAGGG + Intronic
1112917075 13:104565121-104565143 CACACACATATACAGAGTCACGG + Intergenic
1112971124 13:105264201-105264223 GACAATGCTATGCAGATTAATGG - Intergenic
1114942592 14:27633199-27633221 CACATACATATATAGATTTATGG + Intergenic
1115706374 14:36002979-36003001 CACATACATATGCAGATGTCAGG - Intergenic
1116144010 14:41040252-41040274 CACAAGCATATGCTGAATAAAGG + Intergenic
1116535600 14:46025028-46025050 CACACACATATACAAATAAAAGG + Intergenic
1117035437 14:51723214-51723236 CACAATTATATGCACATTATAGG + Intronic
1117312846 14:54545779-54545801 CACAAGCCCATGCAGATTCAAGG + Intergenic
1117675345 14:58150405-58150427 GACAAACATCTACAGAATAAAGG + Intronic
1118333420 14:64831916-64831938 CAAGGACATATGCAAATTAAAGG + Intronic
1119179787 14:72598058-72598080 CACAAACATTTGCAGACCAACGG + Intergenic
1119207271 14:72803850-72803872 CACAAACATGTGCAGTGAAAGGG + Intronic
1120551384 14:85877135-85877157 CACCAAAATATGCAAATCAATGG + Intergenic
1123711675 15:22992512-22992534 CACACACACATGTATATTAATGG + Intronic
1123950108 15:25263073-25263095 CACAAATATATTCACAGTAAAGG + Intergenic
1124878139 15:33615500-33615522 TACAAACATATTCATATAAATGG + Intronic
1128269729 15:66298560-66298582 TACAAATATAACCAGATTAAAGG - Intronic
1129079837 15:73029482-73029504 GATAAACATATGCAGACTAAGGG + Intergenic
1130856785 15:87846553-87846575 CACACACACATGCAGATGTATGG - Intergenic
1131371981 15:91889993-91890015 CACAACTATATGCAGAATATTGG - Intronic
1132788819 16:1673521-1673543 CAGAAACAGATGCAGAGTGAGGG - Intronic
1134428854 16:14181792-14181814 TACAAACAAATGCAGCTCAAGGG - Intronic
1136358473 16:29762099-29762121 CTCAATCACATGCAAATTAAGGG - Intergenic
1140443001 16:75000823-75000845 TACAAAAAGATGCAGATTCACGG - Intronic
1142777885 17:2155766-2155788 CACATACAAATGCAGAGAAAAGG + Intronic
1144114034 17:12068164-12068186 AACAAACAAATTTAGATTAAGGG + Intronic
1146432267 17:32809016-32809038 CACACACATATGTATATTTAGGG + Intronic
1146981757 17:37169028-37169050 TACAAACATATGTACATAAAAGG + Intronic
1149055713 17:52362252-52362274 CACAAAAATATATAGATGAATGG + Intergenic
1149116647 17:53105410-53105432 CACAAATATATGGAGATGAAAGG + Intergenic
1151290996 17:73149870-73149892 GACATACATTTCCAGATTAAAGG + Intergenic
1154934211 18:21034441-21034463 AACAAACTTATACAGATCAATGG + Intronic
1158183061 18:54739590-54739612 CACAAAGATTTGAAGATCAAAGG - Intronic
1159274768 18:66203963-66203985 CAGAAACATAGGCAAAATAAAGG - Intergenic
1159293462 18:66451644-66451666 CATAAACAGTTGCTGATTAAGGG - Intergenic
1159355723 18:67335762-67335784 CACCAACAGATGCAGCTTCATGG + Intergenic
1160054293 18:75464738-75464760 CACAAACGTGTGAAGAGTAATGG + Intergenic
1160180738 18:76633805-76633827 CACAGAAACATGCAGAATAATGG - Intergenic
1162862332 19:13515732-13515754 AACAACCATGTTCAGATTAAGGG + Intronic
1163709058 19:18834616-18834638 CACAAACAAATCCAAATTACAGG - Intronic
1165876418 19:39010714-39010736 TTTAAACACATGCAGATTAAGGG - Intronic
1168340081 19:55617679-55617701 CACAACCATGTGCAGACTGATGG + Exonic
925182541 2:1826598-1826620 CACTAAAAGATGGAGATTAAAGG + Intronic
925935802 2:8758235-8758257 CACAATTTTATGCAGATTACAGG - Intronic
929277467 2:40041704-40041726 AACAAACAGAACCAGATTAAAGG + Intergenic
929657402 2:43747914-43747936 CACAGAAATATGCAGATAAGTGG + Intronic
930268325 2:49226328-49226350 CACGAACAGATGAAAATTAAAGG + Intergenic
930674484 2:54185746-54185768 ACCAATCATATGCAGATTAAAGG + Intronic
930733978 2:54756430-54756452 TAAAAACATAAGCACATTAAAGG - Intronic
930979761 2:57509484-57509506 CACAAGAAAATGCAAATTAAAGG - Intergenic
931024846 2:58099593-58099615 CAGAAACACATGCAGCATAATGG - Intronic
931782132 2:65587883-65587905 CACACACATATGCAGATCGCTGG - Intergenic
931894677 2:66715970-66715992 CACAAATATATGCACATTTGTGG + Intergenic
932097581 2:68865248-68865270 CTCAAATGTATGCATATTAAAGG - Intergenic
932146917 2:69328672-69328694 CACAAACATATTCATATTTCTGG + Intronic
932429037 2:71662976-71662998 CACACACATATGCAGACACATGG - Intronic
935073988 2:99722703-99722725 CCCACACATATGCAGTTTAGGGG + Intronic
935487332 2:103674094-103674116 CACAAACACACACAGCTTAAAGG + Intergenic
935665851 2:105511437-105511459 CACAAACAGATTTGGATTAAGGG - Intergenic
936655948 2:114487886-114487908 CACAAAGATAAGCACGTTAAAGG + Intronic
936699441 2:114993032-114993054 CACAAAAACATACACATTAAAGG - Intronic
936971615 2:118182099-118182121 CAAAATCATCTGCAGATTAATGG + Intergenic
937668273 2:124511951-124511973 CACACACATATACACATTTAAGG - Intronic
939402837 2:141716626-141716648 CAAAAACATATGCAGAGCAGTGG - Intronic
941093720 2:161211400-161211422 AACAAACAAATGTGGATTAAGGG - Intronic
941241341 2:163042014-163042036 CAAAAACATATTTAGATTACAGG - Intergenic
941410056 2:165143398-165143420 CATAAAAATATCCAAATTAAAGG - Intronic
941737776 2:168998687-168998709 TACAAACATATGTGGATTAAGGG + Intronic
942435447 2:175968752-175968774 TACAAATCTATTCAGATTAAAGG + Intronic
943632033 2:190264743-190264765 CCAAAACATATGCAGAAGAATGG - Intronic
943902852 2:193463450-193463472 CACAAACATGTGCATCTAAAGGG - Intergenic
944532125 2:200677496-200677518 CACAAACACATACGAATTAAGGG + Intergenic
945369509 2:208999632-208999654 CACAATTATATGCACATTAAGGG - Intergenic
947504817 2:230699757-230699779 AACAAACATATGGACAATAAAGG + Intergenic
947535909 2:230940338-230940360 CATAATCATCTGCAGATTCAAGG + Intronic
1169334385 20:4743468-4743490 AAAAAACAAATGCATATTAATGG + Intergenic
1169657812 20:7944587-7944609 CACATAAATATGCAGATAAAAGG - Intergenic
1172054841 20:32146908-32146930 CACAAACATATGCACACACACGG - Intronic
1172378379 20:34465550-34465572 CACAAAGATATCCACATTCATGG - Intronic
1174862634 20:54105548-54105570 CACACACATTGGCACATTAAAGG - Intergenic
1175088984 20:56486179-56486201 TACAAACGTACGAAGATTAAAGG - Intronic
1177572241 21:22902080-22902102 TACACACATATGGACATTAAAGG + Intergenic
1177674797 21:24282890-24282912 CAAAGACAAATGCAAATTAATGG - Intergenic
1177739145 21:25132770-25132792 CAAAAACCTATGGAAATTAAAGG + Intergenic
1178093172 21:29185851-29185873 CACAGACATATGCAGAATACTGG - Intergenic
1182678110 22:32056002-32056024 AAAAAACATACGCAGATTACTGG - Intronic
949201149 3:1381047-1381069 GTCCAACATATGCAGATTAGAGG - Intronic
950735632 3:15005701-15005723 CACAGACAGATGCAAAATAAAGG - Intronic
951424155 3:22523054-22523076 CATAAATATATGCACACTAAAGG + Intergenic
952642689 3:35616638-35616660 CATAAACATATACTTATTAAAGG - Intergenic
956511306 3:69996147-69996169 CATAGACATCTGCAGATAAATGG - Intergenic
956521099 3:70105284-70105306 CACAAAGAAAGGCAGACTAATGG - Intergenic
956769539 3:72513069-72513091 CACAAAAACATCCAGAATAATGG - Intergenic
957428973 3:80076887-80076909 TACAGACATGTGCAGACTAAAGG + Intergenic
957619209 3:82573212-82573234 CACATAAAGATCCAGATTAATGG - Intergenic
957975523 3:87439000-87439022 TACAGAGATATGAAGATTAATGG - Intergenic
958065331 3:88537897-88537919 AACCAAAATATGCGGATTAATGG + Intergenic
958617736 3:96516683-96516705 CAGAAACAAAAGCATATTAATGG + Intergenic
959474153 3:106789079-106789101 CACTAACATGTGCAGAATAAAGG - Intergenic
961977940 3:131046537-131046559 CAGATACATATTCTGATTAAGGG - Intronic
963981667 3:151544781-151544803 CACAAAAATCTTCAGATTGAAGG - Intergenic
964918090 3:161860508-161860530 AACATAAATATGCAAATTAAGGG + Intergenic
966203278 3:177379082-177379104 CAAACACAAATGAAGATTAATGG - Intergenic
967218600 3:187230481-187230503 ACCAAACATAAGCAGCTTAAGGG - Intronic
967635242 3:191793017-191793039 CACAAACATATGCACATATATGG + Intergenic
968237587 3:197045044-197045066 CATAAACATATGTAGAAAAAAGG + Intronic
972072711 4:35040858-35040880 AACATAAATATACAGATTAATGG - Intergenic
972861820 4:43178397-43178419 CATAAAAATATGCAGATTGTTGG - Intergenic
973188730 4:47362587-47362609 CACAATCATAACCAGGTTAATGG - Intronic
973258121 4:48133898-48133920 CACACACATATGCAGATTTCTGG + Intronic
974689275 4:65274058-65274080 CACACACATATGGAAATTAATGG + Intergenic
975447213 4:74480011-74480033 CATAAATATATGCAGATATAAGG + Intergenic
975490828 4:74986605-74986627 CACATACACATGAAGCTTAATGG + Intronic
977145730 4:93438093-93438115 CAAAAACATGTGCAGATAAATGG - Intronic
977637027 4:99311263-99311285 CAAAAACAGATGGAGATTAAAGG + Intronic
978162806 4:105569494-105569516 CACAACCAGATACAGAATAATGG + Intronic
978265983 4:106824444-106824466 CACAACTAGATTCAGATTAATGG + Intergenic
978983130 4:114976331-114976353 CACAAATAGAAGCAGATTATAGG + Intronic
980587574 4:134837102-134837124 TACATACATATGTAGATAAAAGG - Intergenic
980667966 4:135963421-135963443 AACAAACATCTGCAAATAAATGG - Intergenic
984387986 4:179088602-179088624 CACAATCAGATGCAATTTAATGG - Intergenic
984746538 4:183225267-183225289 CACAAAAATAGGAAGATCAATGG + Intronic
986843526 5:11725759-11725781 TACAAAAATATGTAAATTAAAGG + Intronic
986910662 5:12551253-12551275 CACATTCATATGCAGAAAAAGGG + Intergenic
987533516 5:19152219-19152241 CACAAAAACCTGCACATTAATGG - Intergenic
987611395 5:20208377-20208399 CACAAACATGTGGGGATTATGGG + Intronic
987975469 5:25009830-25009852 CACATACAAATGCCTATTAATGG - Intergenic
988226055 5:28412440-28412462 TCCAATCATATGCAAATTAATGG + Intergenic
989586658 5:43079037-43079059 CACAATCAGATGGACATTAAGGG + Intronic
990127910 5:52541416-52541438 CACTAACATATGCAAATTTAGGG - Intergenic
991627339 5:68617331-68617353 CACAAAAATATACATATTTATGG - Intergenic
993071421 5:83168726-83168748 CACAAACACAAGAAAATTAATGG + Intronic
994075316 5:95643592-95643614 GACAAAGAAATGCAGATTTATGG + Intergenic
994794098 5:104271460-104271482 CACAAATATACACAGATGAATGG + Intergenic
994867516 5:105295400-105295422 CACAAACATATTAAGAGCAAGGG + Intergenic
994870556 5:105344075-105344097 CACAAACAAAAGAAGATTAAAGG + Intergenic
994901245 5:105772433-105772455 GACAATAATATGCATATTAATGG - Intergenic
995758730 5:115542397-115542419 CACAAACAAATATAGAATAAGGG + Intronic
996943969 5:129044057-129044079 CACAAAGACAGGCAGATTAGAGG - Intergenic
998797040 5:145831704-145831726 GACAAACATTTGGAGACTAAAGG - Intronic
999389792 5:151181650-151181672 CACACACATTGGCATATTAAAGG + Exonic
1000143218 5:158426996-158427018 CATAAACATATGTAAATGAATGG + Intergenic
1000196227 5:158961036-158961058 CACCAAAATATGCATATAAATGG + Intronic
1000830505 5:166095813-166095835 CACAGACATATGCTGATGAAGGG - Intergenic
1000928577 5:167224203-167224225 CAAAAACATAAACAGATAAATGG - Intergenic
1001332612 5:170772928-170772950 CACAAACACATGCACATACAAGG - Intronic
1002372340 5:178765286-178765308 CACAAGCATTTGCTGATGAATGG - Intergenic
1006974471 6:38085772-38085794 CACAAATATATACATATTAAAGG + Intronic
1008725920 6:54418848-54418870 CACCTACATATGCACACTAAAGG + Intergenic
1008754798 6:54781682-54781704 CAAAAACAAATGCAGACAAATGG + Intergenic
1008895542 6:56550121-56550143 CACACACATACACAGATAAATGG + Intronic
1010179426 6:73067947-73067969 TACATACATTTGCATATTAATGG - Intronic
1011837749 6:91454983-91455005 CACAAACATATGTATGTAAAAGG - Intergenic
1012125000 6:95418045-95418067 CACAAATACATGGAGCTTAAAGG - Intergenic
1013911863 6:115285075-115285097 CAGAAACATATGGATACTAAAGG + Intergenic
1014453356 6:121608097-121608119 CACAAGCATATAGAGATTATAGG + Intergenic
1014505515 6:122249268-122249290 CAGACATATATGAAGATTAAAGG + Intergenic
1014710604 6:124802204-124802226 CATTAACATATGCATATTTAGGG - Intronic
1014965968 6:127751412-127751434 CACAAAGAAAGGCAGATCAAAGG + Intronic
1015895373 6:138011650-138011672 GAAAAACATATGCTGAGTAAAGG + Intergenic
1016225273 6:141727606-141727628 CACAAACATATGCAAAAGCAAGG - Intergenic
1016702769 6:147072018-147072040 AACAAACATGTGCAGTTGAATGG + Intergenic
1016761127 6:147738818-147738840 CATATAAATATCCAGATTAATGG - Intergenic
1017381026 6:153829878-153829900 CTCAAACATTTTCAGATGAATGG - Intergenic
1018719048 6:166558456-166558478 CACAGACATACCCAGAATAAGGG + Intronic
1021955755 7:25823000-25823022 ACCAAAGATATGCTGATTAAGGG + Intergenic
1022004989 7:26259551-26259573 CATAAACACATACAGGTTAATGG - Intergenic
1024425310 7:49218347-49218369 CAGAAACTTTTGCAGAGTAAAGG - Intergenic
1027334512 7:77134096-77134118 CACAACCAAATGCAGATTGCAGG - Intronic
1027811541 7:82907033-82907055 TACTAACATATACAGATTTATGG - Intronic
1029576661 7:101407851-101407873 CTTAATCATATGCAAATTAAGGG + Intronic
1029781335 7:102737495-102737517 CACAACCAAATGCAGATTGCAGG + Intergenic
1030215495 7:107041156-107041178 CACAAGCACATTCAGATTCAAGG + Intergenic
1030901893 7:115134946-115134968 CACAAACAAAGGGAGATTCAAGG - Intergenic
1031807043 7:126319218-126319240 CACAATCCTAAGCAAATTAATGG - Intergenic
1031934238 7:127719503-127719525 CAGAAAAACATGAAGATTAATGG - Intronic
1033673077 7:143511584-143511606 CACAAACATCTGCATCTGAAAGG + Intergenic
1035971184 8:4251048-4251070 CACAAGCACCTGCAGATTACTGG - Intronic
1037487259 8:19359258-19359280 CATAATTACATGCAGATTAAAGG + Intronic
1039240636 8:35552561-35552583 CAGAAACATGCCCAGATTAAAGG - Intronic
1039910001 8:41818959-41818981 CCCTAACATATGCACAGTAAAGG + Intronic
1040094677 8:43432207-43432229 CAGAACCTTAGGCAGATTAAGGG + Intergenic
1041114903 8:54526140-54526162 CACAAACAGAAGCTCATTAAAGG - Intergenic
1041454328 8:58041275-58041297 CACTAACATATCCAGATGAAGGG + Intronic
1042289167 8:67149837-67149859 CAAGAACATATGAAGATAAAAGG + Exonic
1042764362 8:72304106-72304128 CAAAAACAAAAGCAGATGAATGG - Intergenic
1043560175 8:81484153-81484175 CACGAACATACCCAGATTTAGGG + Intergenic
1044583204 8:93843049-93843071 TACAACCACATTCAGATTAATGG - Intergenic
1044620201 8:94183376-94183398 CATAAACATATATAGATCAATGG + Intronic
1045471894 8:102520084-102520106 CTCAAAAATATACAGATGAAAGG + Intergenic
1046270089 8:111883825-111883847 TAAAAACATATGCTGTTTAAAGG + Intergenic
1046999588 8:120560520-120560542 CACTACCATATTCAGATTAAAGG - Intronic
1047857388 8:128926471-128926493 GACACACATATGTACATTAATGG - Intergenic
1048694268 8:137007001-137007023 CATAAATAAATGCAGAATAAAGG - Intergenic
1051357189 9:16250379-16250401 CACAAACAGATGCAAATAAGGGG + Intronic
1051976261 9:22953283-22953305 CACACACATATACTGAATAATGG + Intergenic
1052614810 9:30824230-30824252 CACACACATATGCAGATCCCAGG - Intergenic
1055246672 9:74253545-74253567 TACAAAGATATGAAGATAAACGG - Intergenic
1055623107 9:78146339-78146361 AACTAACATATACAGATTACTGG - Intergenic
1057150791 9:92794251-92794273 GAAAAAAATAAGCAGATTAAAGG + Intergenic
1057526575 9:95808233-95808255 CAGAAAAAAATGCAGATTAAGGG + Intergenic
1058921573 9:109620627-109620649 CAGAAAAATGTGCAGATTCAAGG + Intergenic
1186870019 X:13761954-13761976 CACACACATATGCTGAGTTAGGG + Intronic
1187080676 X:15983582-15983604 CAGAAACAAACGCAGGTTAAGGG + Intergenic
1187383592 X:18827610-18827632 CACAAACAGATGCATAGTATGGG + Exonic
1187519169 X:19998686-19998708 CAGAAACACATGCAGATCCAAGG + Intergenic
1187764896 X:22630624-22630646 CACAAAGCAATTCAGATTAAAGG + Intergenic
1188491927 X:30747062-30747084 CAGAAACATATGTAATTTAATGG - Intergenic
1189334664 X:40163659-40163681 CACAAACCCATCCAGATTCAAGG - Intronic
1190548680 X:51556637-51556659 CACTAAGATATGCAGATACAGGG - Intergenic
1193031433 X:76902837-76902859 CAAAAACTTCTGCACATTAAAGG + Intergenic
1193788354 X:85788509-85788531 GCCAACCATATGCAGATTGAAGG + Intergenic
1195591673 X:106635503-106635525 TACAAACATATGAATACTAATGG - Intronic
1197037550 X:121894314-121894336 TAAATACATTTGCAGATTAATGG + Intergenic
1198283653 X:135169147-135169169 CAATAACATTTGCAGATTTACGG - Intronic
1198837221 X:140817565-140817587 CACCCACATTTGCATATTAAAGG - Intergenic
1199089859 X:143679131-143679153 CACACACATATACACATAAAGGG + Intergenic
1199800056 X:151241368-151241390 CAAAAATAGATGTAGATTAATGG + Intergenic
1200872364 Y:8116262-8116284 ATAAAACATATGCAGATGAATGG - Intergenic
1201454289 Y:14151699-14151721 CAGAAACATGTGAAGATTAGTGG + Intergenic