ID: 907102493

View in Genome Browser
Species Human (GRCh38)
Location 1:51849571-51849593
Sequence CTTTGGAAGGTGGAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81859
Summary {0: 3, 1: 47, 2: 683, 3: 8302, 4: 72824}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907102483_907102493 11 Left 907102483 1:51849537-51849559 CCGGGCACGGTGGCTCACGCCTG 0: 10594
1: 61615
2: 115683
3: 148690
4: 163177
Right 907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG 0: 3
1: 47
2: 683
3: 8302
4: 72824
907102486_907102493 -8 Left 907102486 1:51849556-51849578 CCTGTAATCCCGGCACTTTGGAA 0: 98
1: 12506
2: 305838
3: 263550
4: 146364
Right 907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG 0: 3
1: 47
2: 683
3: 8302
4: 72824

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907102493 Original CRISPR CTTTGGAAGGTGGAGGTGGA TGG Intronic
Too many off-targets to display for this crispr