ID: 907104593

View in Genome Browser
Species Human (GRCh38)
Location 1:51870994-51871016
Sequence ATGATGAGGTACACATTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907104593_907104599 16 Left 907104593 1:51870994-51871016 CCAAACAATGTGTACCTCATCAT 0: 1
1: 0
2: 3
3: 11
4: 147
Right 907104599 1:51871033-51871055 TTGGCCGGGCGTGGTGCCTCAGG 0: 1
1: 17
2: 178
3: 916
4: 2673
907104593_907104596 1 Left 907104593 1:51870994-51871016 CCAAACAATGTGTACCTCATCAT 0: 1
1: 0
2: 3
3: 11
4: 147
Right 907104596 1:51871018-51871040 CAAAATTTCTCACTCTTGGCCGG 0: 1
1: 0
2: 2
3: 35
4: 300
907104593_907104598 7 Left 907104593 1:51870994-51871016 CCAAACAATGTGTACCTCATCAT 0: 1
1: 0
2: 3
3: 11
4: 147
Right 907104598 1:51871024-51871046 TTCTCACTCTTGGCCGGGCGTGG 0: 1
1: 3
2: 20
3: 125
4: 902
907104593_907104597 2 Left 907104593 1:51870994-51871016 CCAAACAATGTGTACCTCATCAT 0: 1
1: 0
2: 3
3: 11
4: 147
Right 907104597 1:51871019-51871041 AAAATTTCTCACTCTTGGCCGGG 0: 1
1: 1
2: 7
3: 95
4: 885
907104593_907104595 -3 Left 907104593 1:51870994-51871016 CCAAACAATGTGTACCTCATCAT 0: 1
1: 0
2: 3
3: 11
4: 147
Right 907104595 1:51871014-51871036 CATTCAAAATTTCTCACTCTTGG 0: 1
1: 0
2: 0
3: 20
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907104593 Original CRISPR ATGATGAGGTACACATTGTT TGG (reversed) Intronic
900747840 1:4373254-4373276 ATGAAGAGATACACATGGGTTGG - Intergenic
903114115 1:21164189-21164211 ATTATGAGTTACAAATTCTTAGG - Intronic
904123752 1:28221561-28221583 ATGAGAAGGGACAGATTGTTGGG - Intronic
904529710 1:31160372-31160394 ACTCTGAGGTACACATTATTCGG + Intergenic
904566151 1:31429489-31429511 ATGATGAGGCCCACAATGCTCGG - Exonic
905774217 1:40658106-40658128 AAGGTGAGGTAGACATGGTTTGG + Intronic
907104593 1:51870994-51871016 ATGATGAGGTACACATTGTTTGG - Intronic
908055397 1:60280759-60280781 ATGCTGAGGTCCAAATTGCTAGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
910768486 1:90807128-90807150 AAGATGAAGTACAGATTTTTGGG - Intergenic
915574621 1:156767576-156767598 GTGAAGAGGTACGCCTTGTTCGG + Exonic
916521971 1:165571559-165571581 ATGATGCAGTACACATGGTAGGG + Intergenic
917909120 1:179623158-179623180 ATGATGAGATAGACATTTTCAGG + Intronic
918525404 1:185458977-185458999 ATGATGAGTTTTACCTTGTTGGG + Intergenic
919966806 1:202535245-202535267 ATGGTGCTGTACACATGGTTTGG - Intronic
922683540 1:227620729-227620751 ATGATTGGTTATACATTGTTGGG + Intronic
923074576 1:230598330-230598352 ATGATGAAGTACACATGGCAGGG + Intergenic
923523378 1:234753461-234753483 ATGATGAGGAAGCCATTGCTTGG - Intergenic
1063228252 10:4036448-4036470 CTGATGAAGTTCACTTTGTTTGG - Intergenic
1063602326 10:7493628-7493650 GTGATGTGGTACCCATTGGTGGG - Intergenic
1067303456 10:45035916-45035938 ATGTGGAGTTACACAATGTTAGG - Intergenic
1067460233 10:46452764-46452786 ATGATGAGGTACCGTTGGTTAGG + Intergenic
1067626957 10:47931839-47931861 ATGATGAGGTACCGTTGGTTAGG - Intergenic
1069482835 10:68799112-68799134 TTGGTGTGGTAAACATTGTTAGG + Intergenic
1073159682 10:101380801-101380823 ATTATGAGAAATACATTGTTAGG + Intronic
1073542111 10:104322971-104322993 CTGATGAGGTACACAGTTGTTGG + Intronic
1073954297 10:108850887-108850909 ATGATGAGGTACAAATGGTTGGG + Intergenic
1074102848 10:110367139-110367161 ATGCTGAGGTACAGATGGTTTGG - Intergenic
1077942379 11:6856722-6856744 ATGATTAAGTGCAGATTGTTTGG + Intergenic
1079275420 11:19031613-19031635 ATGCTGAGGTATAGATTGTTTGG - Intergenic
1081947445 11:47009867-47009889 ATGCTGAGAAACTCATTGTTTGG + Intronic
1083136793 11:60686130-60686152 AGGTTTAGGTACTCATTGTTTGG - Intergenic
1089138553 11:116268625-116268647 ATGCTGAGTTACACATCCTTGGG - Intergenic
1093337777 12:17929862-17929884 ATAAAGAGCTACTCATTGTTAGG - Intergenic
1094067310 12:26375149-26375171 ATAATAATGTCCACATTGTTAGG - Intronic
1094711608 12:32969053-32969075 ATGATGTGTTATAGATTGTTTGG + Intergenic
1094747656 12:33364180-33364202 ATGCTGATGTACACTTTATTTGG + Intergenic
1095651106 12:44610345-44610367 ATGATGATGTACGCATGTTTGGG + Intronic
1096126009 12:49120272-49120294 ATGATGATGCCCACATTGTCAGG + Intergenic
1097405283 12:59181765-59181787 ATGAGGAGGGAGACATTGTAAGG + Intergenic
1097803674 12:63942436-63942458 AAGATTTGGTACACTTTGTTAGG + Intronic
1099721892 12:86373444-86373466 AATATGAGGTACATATTGTAAGG - Intronic
1108088501 13:46820835-46820857 GTTATGAGGAACACATGGTTTGG - Intergenic
1109756865 13:66772875-66772897 ATATAGAGGTACACATTGTTTGG + Intronic
1111465236 13:88599677-88599699 ATGAAGAGGTAGGCATTGCTTGG + Intergenic
1114617691 14:24076938-24076960 ATGATGGGGGCCACATTGGTGGG - Exonic
1115369577 14:32597072-32597094 AAGATGAGGTATTCATTATTAGG - Intronic
1115667826 14:35572680-35572702 ATGATGAAGTGCACATTGTTTGG - Exonic
1115754047 14:36516297-36516319 CTGATGAGATTCAAATTGTTTGG - Intergenic
1116163460 14:41301664-41301686 CTGATAAGGGGCACATTGTTTGG - Intergenic
1122280032 14:100616530-100616552 AAGATGGGGTGCACAATGTTGGG + Intergenic
1124191509 15:27581261-27581283 ATGATCAAGAACACATGGTTTGG - Intergenic
1125458813 15:39888677-39888699 AAGATGATTTACACATTGTAGGG - Intronic
1126577165 15:50208578-50208600 ATTATGAGCTACACACTGTTAGG - Intronic
1129814402 15:78539495-78539517 ATGATCAGGTTCACACTTTTGGG - Intergenic
1130643333 15:85700347-85700369 ATGATGAAGCACACATAGCTAGG + Intronic
1133551406 16:6858246-6858268 ATGATGAACTACACTTTGTAGGG + Intronic
1137343681 16:47635478-47635500 AGGATGACTTACACATTTTTTGG + Intronic
1138241591 16:55431720-55431742 ATGAGAAGGAACACATTTTTTGG - Intronic
1139223154 16:65205540-65205562 ATGATGATGCCCACATTATTTGG - Intergenic
1143559297 17:7682897-7682919 ATCATGAGATAAACATTATTTGG + Intronic
1149494744 17:57110114-57110136 ATGATGAGGTCGACCTTCTTAGG - Exonic
1152285231 17:79408666-79408688 CCGATGAGGCCCACATTGTTTGG + Intronic
1154193246 18:12247506-12247528 AGGAAGAGCTACACACTGTTGGG + Intergenic
1156600832 18:38604146-38604168 AAGGTGAGGTACACATTTCTAGG + Intergenic
1157731933 18:50011541-50011563 AGGATGAGGAACAGATTGGTGGG - Intronic
1157901209 18:51519708-51519730 ATAATGAGGTTCACATTGGCTGG - Intergenic
1158507279 18:58057842-58057864 ATGAAGAGGCACACAGTTTTGGG + Intronic
1159766608 18:72498534-72498556 AGGATAAGGGACACATTGGTGGG + Intergenic
1159827181 18:73228166-73228188 ATGAAAATGTACACATTGCTTGG - Intronic
1164919612 19:32079035-32079057 ATGATGAGGTTCAGAATCTTGGG - Intergenic
1165767152 19:38358701-38358723 GTGATGAGGAACACACCGTTAGG + Intronic
1166852218 19:45766400-45766422 TTGATGAGGTGCACATTGGCAGG + Exonic
1167006426 19:46779020-46779042 ATGCTGAAGCACACATTGCTGGG - Intronic
1168598723 19:57700852-57700874 CTGTTGAGCTACACAATGTTTGG + Exonic
925588967 2:5491327-5491349 ATGATGAGGTGCACAGTTTCTGG + Intergenic
927405801 2:22765270-22765292 ATGATGAAGCAAACACTGTTAGG + Intergenic
927529819 2:23785632-23785654 TTGATGAGGTATACATAATTTGG + Intronic
928440362 2:31287093-31287115 ATGCTGAGGGACTGATTGTTGGG - Intergenic
930189869 2:48446468-48446490 ATCATGAGGTTCAAATTATTTGG + Intronic
932802119 2:74750241-74750263 ATGAAGAGGTACACAGGGTGAGG + Intergenic
933072152 2:77872084-77872106 ATTAGGAGGTAGACATTTTTGGG + Intergenic
937834613 2:126459731-126459753 ATGATGAGGTTCTCATTTATGGG - Intergenic
938891578 2:135711061-135711083 ATGAAGAGGTAAATAATGTTTGG - Intronic
939858365 2:147388585-147388607 AGGATGAAGGACACATTGTGGGG - Intergenic
941957586 2:171220253-171220275 ATGATGTAGTACACATCTTTGGG - Intronic
943908818 2:193536420-193536442 ATGATGAAGTACTTATTTTTTGG - Intergenic
944096897 2:195977670-195977692 ATGTTGAGGTAGTCTTTGTTGGG - Intronic
945127514 2:206529122-206529144 CTGATTAGGTACACATTAATTGG - Intronic
945310409 2:208305710-208305732 ATGATGAGGTTTACTTTATTGGG + Intronic
947284226 2:228493838-228493860 AGGATGGGGTGTACATTGTTTGG + Intergenic
1170420907 20:16192161-16192183 ATTCTGAGAAACACATTGTTAGG + Intergenic
1174688582 20:52479847-52479869 CTGATGAGAACCACATTGTTTGG - Intergenic
1174688739 20:52481577-52481599 CTGATGAGAACCACATTGTTTGG - Intergenic
1176815648 21:13599487-13599509 AATTTGAGCTACACATTGTTGGG - Intergenic
1178200565 21:30398448-30398470 ATGATTAGGTATAAATTATTAGG + Intronic
1183274060 22:36880399-36880421 ATCATAAGCTACACATTGTAGGG + Intergenic
955730736 3:61982999-61983021 ATAATGAAATACACATTTTTTGG - Intronic
959201944 3:103256944-103256966 ATTATGAGTTACAGATTTTTGGG - Intergenic
969035137 4:4247367-4247389 ATGATGATGTATACATTTTGAGG - Intronic
972366428 4:38379597-38379619 ATTCTGAGAAACACATTGTTAGG + Intergenic
974169178 4:58244229-58244251 ATGTTGATGTACCCATTATTAGG - Intergenic
976535914 4:86216602-86216624 ATGCTGTGGTAAACATTATTAGG - Intronic
978191278 4:105915349-105915371 ATGGAGAGGCACACAGTGTTAGG + Intronic
978983496 4:114981443-114981465 ATGATGAAGTGCACATTTGTAGG - Intronic
980100487 4:128536835-128536857 ATTATTAGTAACACATTGTTTGG - Intergenic
980684109 4:136203112-136203134 ATGATGGAGTACATTTTGTTGGG - Intergenic
984006628 4:174318424-174318446 ATGAAAAGTTACACATTTTTTGG + Intronic
987761920 5:22175959-22175981 ATAATGATCTACACATTTTTAGG - Intronic
989242282 5:39215421-39215443 ATGATGAGAAGCACATTGTGTGG + Intronic
990101060 5:52187846-52187868 ATGAAGGGGTAGACATCGTTGGG - Intergenic
994311469 5:98277105-98277127 ATGATGAGGCACATAATATTTGG + Intergenic
994427724 5:99614724-99614746 ATGATGAGGTAGCCATTGTAAGG + Intergenic
997901260 5:137767406-137767428 ACATTGAGGTACACATTGTTAGG - Intergenic
1000625709 5:163535672-163535694 ATGATGAGGTACCCACTTTCTGG + Intergenic
1000732468 5:164853414-164853436 TTGATGCAGTAGACATTGTTGGG + Intergenic
1003167774 6:3696321-3696343 ATGATCAGGTAGAGATTGTAAGG + Intergenic
1008697840 6:54062223-54062245 ATAATGAAATAGACATTGTTTGG - Intronic
1011604714 6:89091853-89091875 ATTCTGAGAAACACATTGTTAGG - Intergenic
1011862968 6:91783814-91783836 ATGATGAGGTTCAAATTCTCTGG - Intergenic
1012522996 6:100143246-100143268 AAAATGAGGTCTACATTGTTTGG + Intergenic
1012780779 6:103554506-103554528 ATGAAGAGAAAGACATTGTTTGG - Intergenic
1013218312 6:108052026-108052048 ATGGTGAGGGTAACATTGTTGGG - Intronic
1013640664 6:112075604-112075626 ATGAGGAGGTACAGATTAGTTGG + Intronic
1015178382 6:130336292-130336314 AAAATGAGGTTCACATTGCTAGG + Intronic
1016636000 6:146290984-146291006 ATTATGATGTAGACATTTTTGGG - Intronic
1016669790 6:146690631-146690653 ATGTGGAGGAACACATTGTTAGG + Intronic
1019126275 6:169842322-169842344 AAGATGAGATACACATTTTCGGG + Intergenic
1021621541 7:22554836-22554858 ATGATGAGTCAAATATTGTTAGG - Intronic
1023900427 7:44473277-44473299 ATGCTGATGTTCATATTGTTTGG - Intronic
1027960146 7:84935530-84935552 ATTCTGAGGTACGCATTGTTAGG + Intergenic
1028272140 7:88805131-88805153 ATGATGAGTTACACATTTAATGG + Intronic
1030121911 7:106118501-106118523 ATGCTGAGGTACTAATTGTTTGG - Intergenic
1033013802 7:137651005-137651027 ATGAAAAGGTCCACATTGTCTGG - Intronic
1038712270 8:29958592-29958614 TTGAAGAGGTACACATGGTGGGG + Intergenic
1038896446 8:31788243-31788265 ATTTTGAGGTACACATATTTAGG + Intronic
1041289485 8:56295532-56295554 ATGATGATGGTCACATTCTTGGG + Intergenic
1041441141 8:57898353-57898375 ATTATGAGGGACACAGTGTGAGG - Intergenic
1044291181 8:90472379-90472401 ATGCTGAGGTACAGAATGATGGG - Intergenic
1045713092 8:105009387-105009409 ATGATGAGGAAAAAATTCTTAGG + Intronic
1046377631 8:113407423-113407445 ATGATGAGGTACATAATGTCTGG + Intronic
1046493469 8:114983760-114983782 ATGATGAGATACAGAATTTTTGG + Intergenic
1048086850 8:131190634-131190656 ATGATGGGGAACACAGGGTTGGG + Intergenic
1050255195 9:3786424-3786446 ATGATGAAATAAAAATTGTTTGG + Intergenic
1050431294 9:5564619-5564641 ATGATGATGAAAACAGTGTTTGG - Intronic
1050758472 9:9037153-9037175 AGCCTGAGATACACATTGTTAGG - Intronic
1052724325 9:32211586-32211608 ATGATCATGTACATATTTTTTGG - Intergenic
1052791177 9:32876829-32876851 AAGGTGAGGTGCTCATTGTTTGG + Intergenic
1056888457 9:90467223-90467245 ACTATGAGGTACACATGCTTAGG - Intergenic
1057689083 9:97266975-97266997 ATGAAGAGCTGCACAGTGTTAGG + Intergenic
1058493289 9:105525956-105525978 ATGATGAAGTGCACATTGTTTGG + Intronic
1058619859 9:106871607-106871629 GTGCTCAGGTACACATTCTTTGG + Intronic
1058959068 9:109975819-109975841 ATGAAGAGCTACACATTGCTGGG + Intronic
1059561060 9:115334863-115334885 ATGATGAGGTACATATAGAGAGG - Intronic
1062333042 9:136052894-136052916 AGGATGAAGTACACATTCTCTGG - Intronic
1203531711 Un_GL000213v1:149975-149997 AATTTGAGCTACACATTGTTGGG + Intergenic
1189400735 X:40666359-40666381 ATGTTAGGGTACCCATTGTTGGG + Intronic
1192732276 X:73813014-73813036 AAGAAGTGGTAAACATTGTTAGG - Intergenic
1197801637 X:130355978-130356000 GTGAGGAGGCACACAGTGTTTGG + Intronic
1201738795 Y:17301502-17301524 ATGATGAGGCACACTGTGTGAGG + Intergenic
1202302416 Y:23430999-23431021 ATGGTGCTGTACACATGGTTTGG - Intergenic
1202568395 Y:26239595-26239617 ATGGTGCTGTACACATGGTTTGG + Intergenic