ID: 907116034

View in Genome Browser
Species Human (GRCh38)
Location 1:51969342-51969364
Sequence CCTCATAGACAGAGAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 435}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907116034_907116042 22 Left 907116034 1:51969342-51969364 CCCTCCTTTCTCTGTCTATGAGG 0: 1
1: 0
2: 2
3: 33
4: 435
Right 907116042 1:51969387-51969409 GCTTCTCCTACAGACCTGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 122
907116034_907116040 0 Left 907116034 1:51969342-51969364 CCCTCCTTTCTCTGTCTATGAGG 0: 1
1: 0
2: 2
3: 33
4: 435
Right 907116040 1:51969365-51969387 AAGGCTGTCCATGGAGACAGAGG 0: 1
1: 0
2: 0
3: 25
4: 259
907116034_907116039 -9 Left 907116034 1:51969342-51969364 CCCTCCTTTCTCTGTCTATGAGG 0: 1
1: 0
2: 2
3: 33
4: 435
Right 907116039 1:51969356-51969378 TCTATGAGGAAGGCTGTCCATGG 0: 1
1: 0
2: 3
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907116034 Original CRISPR CCTCATAGACAGAGAAAGGA GGG (reversed) Intronic
900898592 1:5501743-5501765 CCTCGGAGACAGAGACAGTAAGG - Intergenic
901625853 1:10624650-10624672 TGACATAGAGAGAGAAAGGATGG - Intronic
901849351 1:12005723-12005745 CCGCACAGACACAGGAAGGAGGG - Exonic
903565222 1:24260117-24260139 ACTCATAGAAACAGAAAGTAGGG + Intergenic
904145090 1:28384171-28384193 CCTCATAGAATGAGTTAGGAAGG + Intronic
907116034 1:51969342-51969364 CCTCATAGACAGAGAAAGGAGGG - Intronic
907730020 1:57057028-57057050 GCTCATGGTGAGAGAAAGGAGGG + Intronic
908679428 1:66643233-66643255 ACTCATCTACAGAGAGAGGAAGG - Intronic
909054177 1:70803631-70803653 CCTCATAGCCAGTGATGGGAAGG - Intergenic
909183701 1:72457813-72457835 CATCAGAGAGAGAGAGAGGAAGG - Intergenic
909261985 1:73501834-73501856 TTTAATAGACAGAGAAAAGAGGG - Intergenic
909485405 1:76167499-76167521 CCTCATAGAATGAGTAAGGGAGG + Intronic
910082580 1:83358710-83358732 CCTCATAGAATGAGTTAGGAAGG + Intergenic
910109019 1:83661983-83662005 CCTCAAAGCTAGAGAAAGCATGG - Intergenic
910600884 1:89031044-89031066 CCTCATAGAAAGAGTTAGGGAGG + Intergenic
910862606 1:91757156-91757178 CATGAAAGACAGAGAAAGGCTGG - Intronic
912211555 1:107562593-107562615 TCTTATAGACAGGGAAAAGAGGG - Intergenic
913319701 1:117579531-117579553 CCTCAGAGGCAGAGTAAGGAAGG - Intergenic
913575292 1:120166992-120167014 CCACATAGAAAGGGCAAGGATGG - Intronic
913679061 1:121171466-121171488 CCTTCTTAACAGAGAAAGGAAGG - Intronic
914030894 1:143959112-143959134 CCTTCTTAACAGAGAAAGGAAGG - Intronic
914158556 1:145108850-145108872 CCTTCTTAACAGAGAAAGGAAGG + Intronic
914557597 1:148782632-148782654 CCACATAGAAAGGGCAAGGATGG - Intergenic
914615237 1:149347598-149347620 CCACATAGAAAGGGCAAGGATGG + Intergenic
914883808 1:151568878-151568900 CCTCACAGATAAAGAAATGAAGG + Intronic
915116856 1:153606800-153606822 CCTCAAAGGCAGAGCAAGAAAGG - Intergenic
915977076 1:160398562-160398584 CCTCACCGTCAGAGAAAGGAGGG + Intergenic
917393945 1:174571229-174571251 ACTCATAGAGAGAGAATAGAAGG + Intronic
918279687 1:182991957-182991979 CATCAGAGGCAGTGAAAGGATGG + Intergenic
918389996 1:184049653-184049675 CATCATACACAGGGAAAAGAAGG - Intergenic
920305939 1:205018132-205018154 CCTCAGAGACAGAGAAGGAGAGG + Exonic
920466361 1:206190004-206190026 CCTTCTTAACAGAGAAAGGAAGG - Intronic
920528667 1:206685882-206685904 CCGCAGAGAGAGAAAAAGGAGGG - Intronic
920697935 1:208195836-208195858 GGTCATAGACAGAGAAATGAAGG - Intronic
920745781 1:208626899-208626921 CATCATAGACAGATACAGGAGGG - Intergenic
920959347 1:210650865-210650887 CCTCATGGACAAACTAAGGAAGG - Intronic
921572218 1:216793399-216793421 CCTGAGAGACAGAGAAAGAAAGG - Intronic
921921781 1:220677822-220677844 TTTCATAGAAACAGAAAGGATGG + Intergenic
921973892 1:221179922-221179944 GCTCATAGACATAGACAGCAAGG - Intergenic
922551035 1:226494740-226494762 CCTCATACACAGACAGAGGGAGG + Intergenic
924390349 1:243548765-243548787 CCGCATAGGAAGATAAAGGAGGG + Intronic
1062852230 10:753489-753511 CCTAATACACATAAAAAGGATGG + Intergenic
1063739198 10:8798202-8798224 TCACATAGACAAAGAAAGGTAGG + Intergenic
1063897914 10:10701664-10701686 GTGCAAAGACAGAGAAAGGATGG + Intergenic
1063969370 10:11370856-11370878 CCTCACAGAAAGAGAAACAACGG + Intergenic
1065278905 10:24114915-24114937 AATCAAAGACAGAGATAGGATGG - Intronic
1067789459 10:49276788-49276810 CCACATTCACAGAGAAAGTAAGG + Intergenic
1068095087 10:52481420-52481442 CCTCAGTGTCAGAGAAGGGAAGG - Intergenic
1068882410 10:62064528-62064550 CCTCAAAGATAGAGAAATCAAGG + Intronic
1069657784 10:70102888-70102910 CCATGTAGACAGAGACAGGAGGG + Intronic
1070217367 10:74400625-74400647 CCTCATAGAACCAGAAAGTATGG - Intronic
1070374969 10:75821146-75821168 CTTCATAGAATGAGTAAGGAAGG - Intronic
1071300486 10:84252789-84252811 CCTGATAGAGTGAGAAAGAATGG - Intronic
1071454976 10:85840238-85840260 CCTCATAGAATGAGATAGGGAGG - Intronic
1072045224 10:91647794-91647816 CCTCATAAAAAGAGTAAGGGAGG - Intergenic
1072547935 10:96454960-96454982 AGTCATTGACAGTGAAAGGAAGG + Intronic
1075168763 10:120093565-120093587 ATTCATAGAAAGAGAAAGTAGGG - Intergenic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1076445555 10:130511569-130511591 CCTGAAAGCCAGAGCAAGGAGGG - Intergenic
1076509216 10:131000127-131000149 CCTCAAAGAGAGACAATGGAAGG - Intergenic
1076540077 10:131208105-131208127 GCTCAAAGACCAAGAAAGGACGG + Intronic
1078056058 11:8009869-8009891 CCTTATTGACAAAGAAAAGATGG - Intergenic
1078519747 11:12053407-12053429 GCTCATAGACCTTGAAAGGATGG + Intergenic
1078989273 11:16629603-16629625 CTTCATAGAATGAGATAGGAAGG + Intronic
1079409341 11:20172663-20172685 CCAGACAGACAGAGAAGGGATGG + Intergenic
1079644932 11:22851371-22851393 CCTCACAGTCTGAAAAAGGAAGG + Intronic
1079997423 11:27309006-27309028 CCTCATACACATAAAAAGGGTGG - Intergenic
1081069605 11:38595039-38595061 TCTCCTAGGCAGATAAAGGAGGG + Intergenic
1081211760 11:40344133-40344155 CCTCATAGAATGAGTTAGGAAGG - Intronic
1081480303 11:43480294-43480316 CCTCATGGAGACAGAAAGAAAGG + Intronic
1081852160 11:46281378-46281400 CCCCTTAGCCAGAGGAAGGAGGG - Intronic
1082704928 11:56481908-56481930 TCTCAGAAACAAAGAAAGGAAGG + Intergenic
1083443116 11:62689937-62689959 CCCAATGGACAGAGAAAGGGAGG + Intergenic
1084169993 11:67396502-67396524 CCTGATAGAAAGAGAAGGGGCGG - Intronic
1085654894 11:78304984-78305006 CCTCCCAGAGAGAGTAAGGAAGG - Intronic
1086438756 11:86807384-86807406 CATCTTAAACATAGAAAGGAAGG + Intronic
1086699558 11:89885090-89885112 TGTCATAGACCTAGAAAGGAAGG + Intergenic
1086706613 11:89959424-89959446 TGTCATAGACCTAGAAAGGAAGG - Intergenic
1086961477 11:92983244-92983266 AGTCATATACAAAGAAAGGAAGG + Intronic
1087240023 11:95764111-95764133 CCTCACAGATAGATGAAGGAGGG + Intergenic
1087723625 11:101694414-101694436 AATTATAGACTGAGAAAGGAGGG + Intronic
1088456340 11:110036570-110036592 CCACAGAGACAGAGACTGGATGG - Intergenic
1088506068 11:110528633-110528655 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1089627614 11:119761621-119761643 CATCAAAAACAAAGAAAGGAAGG - Intergenic
1089805043 11:121079483-121079505 CCTCATAGCTAGTGAAAGGAAGG - Intronic
1090228051 11:125083392-125083414 GCTCATACACAGAGCCAGGAAGG - Intronic
1091016369 11:132054673-132054695 ACCCAAAGAAAGAGAAAGGAGGG + Intronic
1091448943 12:560910-560932 CGTCATAGACGGAGGAAGGCAGG - Intronic
1091510204 12:1115590-1115612 CCTCTTAGAAAGGGAATGGAGGG - Intronic
1091998898 12:5017302-5017324 TCTCATAAAGAGGGAAAGGATGG + Intergenic
1096034279 12:48450959-48450981 CCTCATAGAATGAGCTAGGAAGG - Intergenic
1096588551 12:52642250-52642272 ACTCACAGGCAGAGAAAGGGAGG + Intergenic
1098525148 12:71479340-71479362 CCTCCTAGAATAAGAAAGGAAGG + Intronic
1099101817 12:78451120-78451142 CTTTATAGACAGAGATGGGAAGG + Intergenic
1099331454 12:81294384-81294406 CCTGAGGGAAAGAGAAAGGAAGG + Intronic
1099802248 12:87472075-87472097 CTTCATGGACAGGAAAAGGAAGG - Intergenic
1100156711 12:91808097-91808119 CCTCATAGAATGAGTTAGGAAGG - Intergenic
1101506155 12:105348462-105348484 TTTCAAAAACAGAGAAAGGAGGG - Intronic
1102739112 12:115190481-115190503 CCACAGAGAGAGAGAAAGCAAGG + Intergenic
1105776230 13:23663525-23663547 CCTCATAGAATGAGTTAGGAAGG + Intronic
1105801863 13:23911936-23911958 CCTAATATACAGAGAGAGGTGGG - Intergenic
1105882143 13:24614532-24614554 CCTCCTGGACAGAGAGAGGCAGG + Intergenic
1106387866 13:29305769-29305791 CCTCATAGAATGAGTTAGGAAGG - Intronic
1106510779 13:30410602-30410624 ACTCAAAGAAAGAGAGAGGAAGG + Intergenic
1106938553 13:34750686-34750708 TCTCAAAGACAGAGAGAGAAAGG + Intergenic
1108043719 13:46363210-46363232 CAACCTAGACAAAGAAAGGAAGG + Exonic
1108476848 13:50828666-50828688 CCTTATAGACAGAATTAGGAAGG - Intronic
1108490304 13:50975066-50975088 CCACATAGCCAGAGTAAGCATGG - Intergenic
1109361791 13:61302784-61302806 CCTCATAGAATGAGTTAGGAAGG - Intergenic
1110334398 13:74310281-74310303 ACTCAGAAACAGAGCAAGGAAGG + Intergenic
1110976464 13:81842052-81842074 TCTCAGAGAGAGAGAAAGGGAGG - Intergenic
1111907292 13:94270120-94270142 TCTCATAGAGAGATAAATGAAGG - Intronic
1112076451 13:95918853-95918875 CCTCATAGAATGAGTAAGGGAGG - Intronic
1112205245 13:97317679-97317701 CCTAATAGACGGAGATATGATGG + Intronic
1112368716 13:98776281-98776303 CATCAGAGTCAGAGACAGGACGG + Intergenic
1116301147 14:43184865-43184887 ATACAGAGACAGAGAAAGGAGGG - Intergenic
1116358037 14:43956436-43956458 CCTCACAGAATGAGTAAGGAAGG - Intergenic
1119112357 14:71986932-71986954 CCTATAAGAGAGAGAAAGGAAGG - Intronic
1119858739 14:77921597-77921619 CAGCATAGACAGAGACAGGAGGG - Intronic
1120596109 14:86439678-86439700 CCTCATGGACAAAGAAAGCAGGG - Intergenic
1120866301 14:89298239-89298261 ACTCATAGATAGAAAAAGAATGG + Intronic
1121021367 14:90582213-90582235 CCTCAGAGGCAGAGAGAGGGGGG - Intronic
1122150477 14:99723183-99723205 TCTCAGAGACAGAGAAAGCAGGG - Intronic
1123141589 14:106084740-106084762 CCTCATAGAAAGAGTTTGGAGGG - Intergenic
1123200063 14:106654386-106654408 CCTCATAGAAAGAGTTTGGAAGG - Intergenic
1125285690 15:38090230-38090252 CCTCAGAAACAGAGAAGGGAGGG - Intergenic
1126956580 15:53939469-53939491 CCTCATAGAAAGAGTTAGGGAGG - Intergenic
1127097102 15:55523441-55523463 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1127340920 15:58043119-58043141 CCTCATAGACAAAGAAATTGAGG - Intronic
1127372922 15:58357105-58357127 CCTCCTAGGAAGAGAAAGGTGGG + Intronic
1127728900 15:61780038-61780060 TCTCACAGACAGGGAGAGGAAGG - Intergenic
1128113200 15:65089191-65089213 CTGCATAGACACAGAATGGATGG + Intergenic
1129170970 15:73807573-73807595 CCTCAAAGATTGAGAAAGGGGGG + Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1133237791 16:4395686-4395708 CCTCACAGACAGACAAACGGAGG + Intronic
1133574115 16:7071070-7071092 ACTCAAAGCCTGAGAAAGGAGGG + Intronic
1133932710 16:10245168-10245190 CCTCAGAGGCAGAGCAAGCAGGG - Intergenic
1134584329 16:15397137-15397159 CCCCAGAGAAAGAGACAGGAGGG + Intronic
1134688351 16:16174356-16174378 ATTAATAGACAGAAAAAGGAAGG - Intronic
1135500853 16:22994649-22994671 GCTCAGAGCCAGAGGAAGGAAGG - Intergenic
1135847612 16:25932959-25932981 CATCATTGACAGCTAAAGGAGGG - Intronic
1135940018 16:26814507-26814529 CCTCATCAACAGAGAAGGAAGGG + Intergenic
1136191960 16:28622179-28622201 CCCCAGAGAAAGAGACAGGAGGG - Intronic
1137002585 16:35242601-35242623 TCTCATAGACAGAAACAGAAAGG + Intergenic
1137272789 16:46913422-46913444 TCTCACAGACAGAGAAGGGCTGG - Intronic
1137376234 16:47954333-47954355 CCTCTCAGACAGACAAAGGCTGG + Intergenic
1137433172 16:48434677-48434699 CGTCAGAGACACAGAAAGGAGGG - Intronic
1138337141 16:56262085-56262107 CCTCAAAGTGTGAGAAAGGATGG + Intronic
1138992961 16:62413941-62413963 CCTCATAGAAAGAGTTAAGAAGG + Intergenic
1139939215 16:70592372-70592394 TCTCATGGGCAGAGAGAGGAGGG - Intronic
1140277716 16:73525719-73525741 CCTCCTAGAGAGACCAAGGAAGG + Intergenic
1141256554 16:82408041-82408063 CATCACAGCCAGAGAACGGAGGG + Intergenic
1142333382 16:89470500-89470522 CACCATAGACTGAGAAAGGAGGG + Intronic
1142361116 16:89627571-89627593 TCTCAGAGAGAGAGAGAGGAAGG + Intronic
1143685615 17:8513208-8513230 CCTCATAAACAGACATAGGAAGG + Intronic
1144203017 17:12958135-12958157 TCTCATTGACTGGGAAAGGATGG + Intronic
1144532472 17:16052729-16052751 CCTCATAGAATGAGATAGGGAGG - Intronic
1146470143 17:33117615-33117637 CATCAGAGACATTGAAAGGAAGG + Intronic
1146747698 17:35346543-35346565 CCCCTTAGACAGAGAAGGGAAGG - Intergenic
1146981339 17:37164549-37164571 CATTAAAGACAGAGAAAGGAAGG + Intronic
1149662777 17:58344141-58344163 CCTCATAGCCATGGAAAGCAGGG + Intergenic
1149736961 17:59004103-59004125 CCTGAGGGACAGAGGAAGGAAGG + Intronic
1151287573 17:73124040-73124062 CCTCATAAAAACAGGAAGGAAGG - Intergenic
1151520484 17:74625611-74625633 CCTCCTAGACAGAGAGAAAAAGG + Intergenic
1153366686 18:4265018-4265040 TCTGATGCACAGAGAAAGGAAGG - Intronic
1153643648 18:7175812-7175834 CCATCTAGAAAGAGAAAGGAGGG - Intergenic
1153787738 18:8549606-8549628 CCTAATAGATAGGGAGAGGATGG + Intergenic
1154235558 18:12602224-12602246 CTTCCTAAATAGAGAAAGGAAGG - Intronic
1154334758 18:13456467-13456489 CATCATAGAAAGAGAAAGAAAGG - Intronic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1156228151 18:35129259-35129281 GCTCCAAGACAGAAAAAGGAGGG - Intronic
1156422424 18:36969766-36969788 CCTCATAGAAAGAGTTAGGGAGG - Intronic
1157003611 18:43556113-43556135 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1157160362 18:45308522-45308544 CCTCATGCAGAGATAAAGGAGGG - Intronic
1157183219 18:45516270-45516292 GCTGAAAGAAAGAGAAAGGAAGG - Intronic
1157967463 18:52224349-52224371 CCAGAGAGAAAGAGAAAGGAAGG - Intergenic
1157990974 18:52495949-52495971 CCTTATAAACATAGAAAGCAGGG - Intronic
1158243237 18:55401634-55401656 CCCCACAAACGGAGAAAGGAGGG + Intronic
1158269233 18:55695022-55695044 CCACATAGAGAGAGAAAGAGAGG + Intergenic
1159506360 18:69342080-69342102 CCTAAAAGCCAGAGAAAGAACGG + Intergenic
1159607431 18:70489698-70489720 CCTCTGAGACAGAGAGAGAAAGG - Intergenic
1159727218 18:71976138-71976160 GCTCAGAAAAAGAGAAAGGAAGG - Intergenic
1159923819 18:74249313-74249335 CATCAAAGACAGTGAAAGCATGG + Intergenic
1159997304 18:74978636-74978658 CATCCTAGATTGAGAAAGGAGGG + Intronic
1160018536 18:75162898-75162920 CCTCACAACCAGACAAAGGAAGG + Intergenic
1160056477 18:75486787-75486809 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1160564912 18:79781037-79781059 CTTCATAGGGAGAAAAAGGAGGG - Intergenic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1162010122 19:7808110-7808132 GATCATAGACAGATAAAGAAAGG - Intergenic
1162776445 19:12982698-12982720 ACTGAGAGACAGAGAAATGAGGG - Intergenic
1163175603 19:15562366-15562388 GCTCACAGTCAGAGCAAGGACGG + Intergenic
1163611117 19:18302186-18302208 CCTCACAGATGGAGAAATGAAGG - Intergenic
1163903297 19:20127031-20127053 AATCAAAGACAGAGAAATGAAGG - Intronic
1164232104 19:23298803-23298825 CCTCATAGAAAGAGTTAGGAAGG + Intergenic
1164452909 19:28382055-28382077 CCTCAGAGACAGAGAACAGTGGG + Intergenic
1165253728 19:34559967-34559989 TTTAATAGACAGACAAAGGAAGG + Intergenic
1165360485 19:35333554-35333576 TCTCATAAAAAGGGAAAGGAAGG - Intronic
1165522287 19:36324052-36324074 CATCATAGACAGAGACAAGTGGG + Intergenic
1166050041 19:40253511-40253533 ACTCATCCACAGAGAAAGAAAGG + Intronic
1166391036 19:42409054-42409076 CCTGAAAGTCAGAGAGAGGATGG + Intronic
1168187998 19:54713484-54713506 CATCACAGAGAGCGAAAGGAAGG - Intergenic
1168376424 19:55883729-55883751 CCTCATAGAAGGAGAATGTACGG - Intergenic
925506714 2:4573740-4573762 ACTCAGAGAGAAAGAAAGGAAGG + Intergenic
925882410 2:8363806-8363828 CCTCATCAGCAGAGACAGGAAGG - Intergenic
928295936 2:30084056-30084078 TCTCATAGAAATAGAAAGCAAGG + Intergenic
929037193 2:37705598-37705620 CTTAATAGACAGATAAATGAAGG - Intronic
929253354 2:39782440-39782462 CCTCAAAGAAAAAGAAAGAAAGG - Intergenic
929823944 2:45295505-45295527 CATCGTAGGCAGAGAAAGGAGGG + Intergenic
930300261 2:49606717-49606739 CTTGATAGACATAGAGAGGATGG - Intergenic
931430073 2:62202319-62202341 TTTCAGAGGCAGAGAAAGGAAGG + Intronic
933173476 2:79151597-79151619 CCTCATAGAATGAGTTAGGAAGG + Intergenic
933550250 2:83767678-83767700 CCTCATAGAATGAGTTAGGAAGG - Intergenic
935803182 2:106719318-106719340 CCTCATAGAATGAGTTAGGAGGG + Intergenic
936452194 2:112642175-112642197 CTTTATAGACAGAGAAACGGAGG - Intergenic
936634161 2:114236285-114236307 CCAAAGAGACAGAGAGAGGAAGG + Intergenic
936847676 2:116856163-116856185 CCTCATAGAATGAGCAAGGGAGG - Intergenic
937484777 2:122303822-122303844 CCTCATAGAATGAGTTAGGAAGG - Intergenic
937626555 2:124050512-124050534 GATCTTAGAAAGAGAAAGGAAGG + Intronic
938145184 2:128828331-128828353 CCTCATAGAATGAGTTAGGAAGG - Intergenic
938305061 2:130247621-130247643 CCTCATAGAAAGGGAAACAAGGG - Intergenic
938506878 2:131894308-131894330 CTTCAAAGACATAGAAAGGAGGG - Intergenic
940563583 2:155332713-155332735 CCTCATAGAATGAGTTAGGAAGG + Intergenic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
941732573 2:168934550-168934572 CCTCCTAGGCAGAGACAGCATGG - Intronic
941925583 2:170891200-170891222 CCTGATACCCAGAGAAAGGCAGG + Intergenic
943201636 2:184834561-184834583 TCTGAGAGAGAGAGAAAGGAAGG - Intronic
943566943 2:189527071-189527093 CGTCATAGCAAGAGAAGGGAGGG - Intergenic
946063414 2:216965746-216965768 AATCAGAGACAGAGAGAGGAAGG + Intergenic
946195851 2:218032789-218032811 CCCCACAGACAGAGGAGGGAGGG + Intergenic
946629205 2:221647885-221647907 CTTAATAGACAGAGAAAGCATGG + Intergenic
946717807 2:222571704-222571726 CCTAATATGCAGGGAAAGGATGG + Exonic
947141290 2:227021522-227021544 CCACATAAAAATAGAAAGGATGG + Intronic
947148728 2:227092384-227092406 CCCCAGAGAAAGAGAGAGGATGG + Intronic
947265653 2:228277229-228277251 CCTCATAGAATGAGTTAGGAAGG - Intergenic
947973927 2:234347713-234347735 CATCAAAGACAGAGGAAGAATGG + Intergenic
948069756 2:235111078-235111100 ATTCATAGAGAGAGAAAGAATGG + Intergenic
948179625 2:235969538-235969560 CCATAGAGAAAGAGAAAGGATGG - Intronic
1169079929 20:2791620-2791642 TCTCATAAAAAGAAAAAGGAAGG + Intergenic
1169649302 20:7849217-7849239 TCACAAAGAGAGAGAAAGGAGGG + Intergenic
1170970668 20:21113312-21113334 ACCATTAGACAGAGAAAGGAAGG - Intergenic
1171337217 20:24395321-24395343 CCTCACAGACAGAGAAAGCAAGG + Intergenic
1171888937 20:30689779-30689801 CTTCAGAGGAAGAGAAAGGAAGG - Intergenic
1172595941 20:36151271-36151293 CCTCCTAGACAGAGCAGAGAGGG + Intronic
1173187363 20:40850684-40850706 TCTCATGGACATGGAAAGGAGGG + Intergenic
1173214935 20:41072347-41072369 CCTCATTAACAGTGAAATGATGG - Intronic
1174031974 20:47636162-47636184 CCTCAGTGACAAAGAAAGTAAGG + Exonic
1174210628 20:48875330-48875352 CATTGTAGACACAGAAAGGAGGG + Intergenic
1174831398 20:53815831-53815853 CCTCATAGAATGAGATTGGAAGG + Intergenic
1175756508 20:61533575-61533597 CCTCATGGGCAGAGGAAGGCAGG - Intronic
1176671603 21:9740008-9740030 TCTCAGAGAGAGAGAGAGGATGG - Intergenic
1176786757 21:13265977-13265999 CTTCAAAGACATAGGAAGGAGGG + Intergenic
1177351404 21:19946635-19946657 CCTCATAGAACGAGTTAGGAAGG + Intergenic
1177985365 21:27968065-27968087 CTTGAAAGACATAGAAAGGAGGG + Intergenic
1178109693 21:29357739-29357761 CATCACAGAGAGAGCAAGGATGG - Intronic
1179300658 21:40106479-40106501 CCTCATAGAACGAGTTAGGAAGG + Intronic
1179798021 21:43796987-43797009 CAGCACAGGCAGAGAAAGGAAGG - Intronic
1181921091 22:26320994-26321016 CCTGAAAGACAGAGAGAAGATGG + Intronic
1182225568 22:28795583-28795605 CCCCACTGACAGAGAAAGGGAGG + Exonic
1182303275 22:29350717-29350739 CTCCACAGACAGAGAAAGGACGG + Intronic
1185163914 22:49246073-49246095 GTTCAGAGACAGAGAGAGGATGG + Intergenic
1185344249 22:50304486-50304508 CCTGGTAGGCAGAGAAAGGCAGG + Intronic
950278089 3:11680985-11681007 ACCCATAGAAAGAGAAGGGAAGG - Intronic
950689896 3:14647331-14647353 CCTCATAGAGAGGGACGGGAGGG - Intergenic
950866206 3:16191120-16191142 CCTCATAGTGAGAGAGAAGATGG - Intronic
950947890 3:16969251-16969273 CCTCATAGAATGAGTTAGGAAGG + Intronic
951635009 3:24764238-24764260 AAACATAGGCAGAGAAAGGATGG - Intergenic
952982665 3:38750823-38750845 TCTCAGGAACAGAGAAAGGAGGG + Intronic
954756842 3:52845333-52845355 ACTCATGGACAGAGAAGGGAGGG - Intronic
959295979 3:104534600-104534622 CCTCATAGAATGAGTTAGGAAGG - Intergenic
960166170 3:114404174-114404196 ACTGATATACAAAGAAAGGAAGG - Intronic
960208895 3:114935945-114935967 CCTCAAAATCAGAGAAAGGGGGG + Intronic
960690816 3:120344616-120344638 CATCATGAACAGAAAAAGGAAGG + Intronic
962901255 3:139763855-139763877 CCTCATACACATAGAAACTAAGG - Intergenic
963219701 3:142795479-142795501 CATCATATACAGAAAAAGAAAGG + Intronic
963322827 3:143827998-143828020 CCACATGGACAGAGAAGGGCAGG - Intronic
963518170 3:146334423-146334445 CCTAAGAGACAAAGGAAGGAGGG + Intergenic
963927920 3:150970777-150970799 CCTCACAGAAAGCAAAAGGAGGG + Intronic
964061790 3:152533607-152533629 CCTCATAGAATGAGTAAGGGAGG + Intergenic
964542148 3:157791311-157791333 CCTCATAGAGACAGGCAGGAAGG + Intergenic
965159967 3:165120305-165120327 CCTCATAGAATGAGTTAGGAAGG + Intergenic
965490396 3:169328078-169328100 CCTCATAGACACTGAAAGGAGGG - Intronic
966156882 3:176926217-176926239 CCACTAACACAGAGAAAGGAGGG + Intergenic
966822174 3:183933621-183933643 CCACACAGGCAGATAAAGGAGGG + Intronic
966894398 3:184432527-184432549 TCACATAGACAGACAAAAGAGGG - Intronic
967324179 3:188222642-188222664 CCCCAGAGACAGAGAAAGAGAGG - Intronic
968809830 4:2794787-2794809 CCACATGGACAGAGGAAGCAGGG + Intronic
969247928 4:5947659-5947681 CCTCAGAGGCAGCAAAAGGAAGG - Intronic
970069987 4:12147398-12147420 GCACATAGACAGAGAAATTAAGG + Intergenic
970176409 4:13344025-13344047 ATTCATAGAGACAGAAAGGATGG + Intergenic
970569346 4:17364556-17364578 CCTCAAAGACAAAGAAAGAATGG + Intergenic
971128142 4:23776759-23776781 CCTCTCAGATAGAGAAAGAAAGG + Intronic
971595936 4:28528751-28528773 TCTCACAGATAGAGAAAGGGGGG + Intergenic
972010502 4:34174548-34174570 CCTCATAGAATGAGACAGGGAGG - Intergenic
972039501 4:34574604-34574626 CCTCAGCTCCAGAGAAAGGAAGG - Intergenic
972124380 4:35744786-35744808 CCTCATAGAATGAGTTAGGAAGG - Intergenic
972276322 4:37561122-37561144 CCTCAGAGATAAGGAAAGGATGG - Intronic
972405169 4:38738660-38738682 CCTCCTTGACAAAGAAAAGATGG + Intergenic
972965024 4:44498920-44498942 CCTCATAGAAAGAGTTAGGGAGG + Intergenic
973635423 4:52857731-52857753 CCACAGAGAGAGAGAAAGCAGGG - Intergenic
973913776 4:55611916-55611938 TCTCATATACAGAGGAAGTAAGG + Intronic
974664349 4:64938320-64938342 ACCCAGAGACAGAGTAAGGAGGG - Intergenic
976533992 4:86190256-86190278 CCTCATAAAATGAGTAAGGAAGG + Intronic
977317622 4:95470421-95470443 CCTGGTCGACAGAGAATGGACGG + Intronic
978025288 4:103865954-103865976 CCTCATAGAATGAGTTAGGAAGG + Intergenic
978086384 4:104660694-104660716 GTTTACAGACAGAGAAAGGAAGG + Intergenic
980061258 4:128132595-128132617 CTTCAGAGAAAGAGAAATGAAGG + Intronic
980642250 4:135596041-135596063 CTGCATACACAGAGAAAGTAAGG - Intergenic
981055606 4:140358006-140358028 CGTTAGAGAGAGAGAAAGGAAGG - Intronic
981153713 4:141409222-141409244 CCTAATACACCAAGAAAGGAAGG + Intergenic
981265757 4:142781398-142781420 CCTTAAAGACAGAAAAAGGAGGG + Intronic
981275653 4:142895950-142895972 CCTCATAGAATGAGTTAGGAAGG + Intergenic
981310975 4:143297910-143297932 CCTCATATTCAAAGAAAGGCAGG - Intergenic
981819686 4:148871681-148871703 ATTCATAGAAACAGAAAGGATGG + Intergenic
982531264 4:156547105-156547127 TCTAATAGATAGAGAAAGGGAGG - Intergenic
982906159 4:161075760-161075782 TTTCCTAGAAAGAGAAAGGAAGG + Intergenic
983491181 4:168391421-168391443 CCACATAGAAAGTAAAAGGAAGG + Intronic
984854601 4:184183954-184183976 GCTGGTAGACAGGGAAAGGAAGG - Intronic
987792389 5:22584729-22584751 ACTTATAGAGAAAGAAAGGATGG - Intronic
988645500 5:33091260-33091282 CCTCATAGAATGAGTTAGGAAGG + Intergenic
989276196 5:39592573-39592595 CCACATACACACAGGAAGGAAGG + Intergenic
989468512 5:41786241-41786263 CCACACACACAGAGAGAGGAAGG + Intronic
989674379 5:43956502-43956524 CCTCATAAAAAGAGTAAGGAAGG - Intergenic
989741235 5:44774954-44774976 TCACAGAGACAGAGAATGGAAGG - Intergenic
989789210 5:45374628-45374650 CCTCATAGAATGAGTTAGGAAGG - Intronic
990393824 5:55355550-55355572 TCTCATAGTCAGAGATAGGCTGG + Intronic
990873500 5:60459484-60459506 CCCAAGATACAGAGAAAGGAGGG + Intronic
990933494 5:61120453-61120475 CCTTTTAGACTGAGAAAGGTGGG - Intronic
992354107 5:75962813-75962835 CCACATAGACTGAGAATGGGAGG + Intergenic
992744056 5:79801951-79801973 CCACAGAGTCAGAGACAGGAGGG - Intergenic
993397794 5:87412566-87412588 CCGCAGAGGCAGAGAAACGACGG + Intronic
993986644 5:94605397-94605419 CCTCATAGAATGAGTTAGGAAGG - Intronic
994059354 5:95456749-95456771 CCTCCTTGAGAGAGGAAGGATGG + Intergenic
994296709 5:98098304-98098326 ACTCATAGACAGAAAAACAAAGG - Intergenic
994310427 5:98262763-98262785 CCCAAAAGCCAGAGAAAGGAAGG + Intergenic
994796340 5:104305517-104305539 CAACATAGACAGAGAATGGAAGG - Intergenic
995508631 5:112885689-112885711 CCCCACTGACAGAGAAAGGGAGG - Intronic
996545203 5:124670691-124670713 AGACAGAGACAGAGAAAGGAAGG + Intronic
996735967 5:126758728-126758750 CCTGCTAGACAGAAAAAGGGTGG - Intergenic
996953881 5:129160526-129160548 CCTCATAGAATGAGTAAGGGAGG + Intergenic
998002141 5:138633721-138633743 CCTCAGAGAAAAACAAAGGATGG - Intronic
998384305 5:141747636-141747658 CACCAGACACAGAGAAAGGAGGG + Intergenic
998920994 5:147067662-147067684 ACTTATAGACAGAGAAAGTGGGG - Intronic
998957251 5:147451359-147451381 CCACACACAGAGAGAAAGGATGG + Intronic
999141660 5:149366338-149366360 CTTCACAGACAGTGAAAGCAAGG + Intronic
1000691284 5:164324874-164324896 CCCCATAGACAGAGAAACTGAGG + Intergenic
1001451555 5:171829008-171829030 ACTCATGGCCTGAGAAAGGAGGG - Intergenic
1002167391 5:177356839-177356861 CCTTATAAAAAGAGACAGGAGGG + Intergenic
1002795712 6:469706-469728 ACACAGAGACAGAGAGAGGAGGG - Intergenic
1003145181 6:3504422-3504444 CCCCAGACACAGGGAAAGGAAGG + Intergenic
1003237612 6:4310803-4310825 CCTTATAGGCAGAGAGAGAATGG + Intergenic
1005400053 6:25422863-25422885 CCTCAGGGGCAGAGCAAGGAGGG - Intronic
1005852070 6:29829443-29829465 CCTCATAGTCAAAGACAGGGTGG - Exonic
1007221361 6:40281650-40281672 CCTGGCAGAGAGAGAAAGGAGGG + Intergenic
1007746550 6:44046796-44046818 CCTCACAGCCAGCCAAAGGAAGG + Intergenic
1008251358 6:49243943-49243965 CCTCTTAGTCAGAGAATGGAGGG + Intergenic
1008860599 6:56144846-56144868 TCTCATAGAAAGTAAAAGGAAGG - Intronic
1008974890 6:57413631-57413653 ACTCATTTACATAGAAAGGAGGG + Intronic
1009163775 6:60315137-60315159 ACTCATTTACATAGAAAGGAGGG + Intergenic
1009553568 6:65132194-65132216 CCTCATAGAATGAGTTAGGAAGG - Intronic
1011139977 6:84141963-84141985 TCTGAGAGACTGAGAAAGGACGG - Intronic
1012714919 6:102656518-102656540 GGACATAGAGAGAGAAAGGATGG + Intergenic
1014214164 6:118736840-118736862 CATCAGAGGCAGAGAAGGGAAGG + Intergenic
1015588510 6:134800652-134800674 CTGCATACAGAGAGAAAGGATGG - Intergenic
1015864891 6:137718023-137718045 GCTCATACACAGAGAAAAGGCGG - Intergenic
1016657740 6:146541472-146541494 CTTTATAGATAGAGAAAGCAAGG + Intergenic
1016663452 6:146607910-146607932 CCTCATAGAATGAGATAGGGAGG + Intronic
1017380279 6:153820500-153820522 CCTCTAAGAAAGAGAAAGGAAGG - Intergenic
1017557301 6:155584984-155585006 ATTTATAGACAGAAAAAGGAAGG - Intergenic
1017900352 6:158714063-158714085 CCTCATAGGAAGAGAAATGGTGG + Intronic
1018357941 6:163037554-163037576 GCTCAAAGCCAGGGAAAGGATGG - Intronic
1018958157 6:168427135-168427157 GCTCAGAGCAAGAGAAAGGAAGG - Intergenic
1019885587 7:3901762-3901784 CCTAATAAACACACAAAGGATGG - Intronic
1020371392 7:7435825-7435847 CCTCATAAACAGAGATATGCTGG + Intronic
1020631029 7:10640031-10640053 CCCCAAAGACAGACAAAGGGAGG - Intergenic
1020871340 7:13632939-13632961 CTTCATAGAATGAGATAGGAAGG - Intergenic
1021165279 7:17331581-17331603 CCTGCTAGACAGAGAAATTATGG + Intronic
1021165439 7:17333942-17333964 CTTCATGGACAGAAAAAGAAAGG + Exonic
1021614330 7:22487027-22487049 TCACATAGATAGAGGAAGGAAGG + Intronic
1023211655 7:37812049-37812071 CCTCATAGAATGAGTAAGGGAGG - Intronic
1023813925 7:43934148-43934170 CTTCATAGCCACAGAAAGGAAGG + Intronic
1024754110 7:52507988-52508010 CCTCAGAGACAGTGAAACAAAGG + Intergenic
1024907167 7:54398755-54398777 CATAATAGGAAGAGAAAGGAGGG - Intergenic
1026261715 7:68761255-68761277 GTTCATGGACAGAGAAGGGAAGG - Intergenic
1026379374 7:69783752-69783774 CCTCAGAAACAGGCAAAGGAAGG - Intronic
1027299419 7:76814924-76814946 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1028295508 7:89124897-89124919 CCTGATAGACAAAAAGAGGATGG - Intronic
1030527119 7:110667645-110667667 TCTCGAAGCCAGAGAAAGGAAGG + Intronic
1030705944 7:112692924-112692946 ACTCATGGACAGAGAATAGAAGG - Intergenic
1032459453 7:132099304-132099326 CCTCAAAGTCAGAGAAATCAGGG + Intergenic
1032984923 7:137327404-137327426 CCTCAGAGACAGAAAACAGAGGG - Intronic
1033105555 7:138518667-138518689 CCTCACAGACAGAGACAGAGAGG - Intronic
1034890531 7:154835273-154835295 CGTCAGAGGCAGGGAAAGGAAGG + Intronic
1034893733 7:154861964-154861986 CCTTAATGACAGAGAATGGATGG - Intronic
1035385308 7:158468433-158468455 CTTCAGAGAAAAAGAAAGGACGG + Intronic
1035428264 7:158796942-158796964 CCTGAGTGACAGAGACAGGAAGG + Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1037198396 8:16220451-16220473 CCTCATAGAATGAGTTAGGAAGG + Intronic
1037471370 8:19214912-19214934 CCTCAAAGACTGAGAAATAAGGG + Intergenic
1038013467 8:23493720-23493742 TCCCATACACAGAGACAGGATGG + Intergenic
1038185579 8:25271487-25271509 CCTTAAAGACGGAGAAATGAGGG - Intronic
1038566980 8:28627887-28627909 GCTCATAGAGACAGAAAGCATGG + Intronic
1040961853 8:53042710-53042732 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1041195298 8:55396016-55396038 CCTTATAAAAAGAGACAGGAGGG - Intronic
1042349570 8:67763400-67763422 AGACAGAGACAGAGAAAGGAAGG - Intergenic
1042750883 8:72156267-72156289 CCAGAAAGAAAGAGAAAGGAAGG - Intergenic
1042945690 8:74152544-74152566 CATACTAGACAGAGAAAGAAAGG - Intergenic
1044323683 8:90835409-90835431 CCTCATAGACAGATAGTGGAGGG - Intronic
1044387788 8:91610424-91610446 TATCTGAGACAGAGAAAGGAAGG - Intergenic
1044570400 8:93711592-93711614 CCTCTTAAACTGAGCAAGGAAGG + Intronic
1044869553 8:96605562-96605584 TCTCATAGTAATAGAAAGGACGG + Intronic
1045058463 8:98390650-98390672 CATCAGAGACCCAGAAAGGAAGG - Intergenic
1045249976 8:100475023-100475045 CCTCACTGACAGAGATTGGAGGG + Intergenic
1045558921 8:103241855-103241877 CATCAGAGAGGGAGAAAGGAAGG - Intergenic
1045673086 8:104578519-104578541 CCTCATAGAATGAGTTAGGAGGG - Intronic
1045764439 8:105649890-105649912 CCTCATAGACTGAGTTAGGGAGG + Intronic
1047159278 8:122358879-122358901 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1047584115 8:126250510-126250532 CTTGCAAGACAGAGAAAGGAAGG - Intergenic
1049237043 8:141517645-141517667 CCTTGTAGACAGAGACAGGGAGG - Intronic
1051425928 9:16931426-16931448 CCTTATAGAAAGCGAAAAGAAGG - Intergenic
1051560774 9:18438193-18438215 AATCATAGGAAGAGAAAGGAGGG + Intergenic
1051914216 9:22188561-22188583 CCTCATAGACTGAGTTAGGGAGG - Intergenic
1052270865 9:26626631-26626653 CTTCCTAGACAGAGCAAGCAAGG + Intergenic
1052565677 9:30147285-30147307 CATCATAGATATAGAAAGAAAGG + Intergenic
1055829762 9:80364300-80364322 CCTCATAGAATAAGAGAGGAAGG - Intergenic
1056061910 9:82892165-82892187 CCTAGTAGACAAAGCAAGGAGGG - Intergenic
1056962512 9:91138649-91138671 CTTCACAAAAAGAGAAAGGAAGG - Intergenic
1057177492 9:93010632-93010654 ACACAGAGACAGAGGAAGGAGGG + Intronic
1057177505 9:93010701-93010723 ACACAGAGACAGAGGAAGGAGGG + Intronic
1057386932 9:94612971-94612993 TCAGATAGGCAGAGAAAGGAAGG - Intronic
1058064195 9:100530718-100530740 CCTCATAAAAAGAGTTAGGAAGG - Intronic
1058517611 9:105792791-105792813 CCTCATAGAATGAGTAAGGGAGG + Intergenic
1058702660 9:107613703-107613725 CCTTATTGACAGAGAAATGGGGG + Intergenic
1059149779 9:111938923-111938945 CCCCATAGACAGGGAAAGTGAGG - Intergenic
1059498417 9:114729681-114729703 CCTCATAGACTGAGAATCCATGG + Intergenic
1062671434 9:137712143-137712165 GTTCAAAGACACAGAAAGGACGG - Intronic
1062721611 9:138047147-138047169 GCACACAGACAGAGGAAGGAGGG - Intronic
1185516930 X:707048-707070 CCTCAGAGAAAGAGAGAGGGGGG + Intergenic
1185659161 X:1713147-1713169 ACTCAAAGACAGACAGAGGAGGG + Intergenic
1186728925 X:12387138-12387160 ACTCAGAGACAAAGAAAGGATGG - Intronic
1187034356 X:15522242-15522264 CTTGAAAGAGAGAGAAAGGAAGG - Intronic
1187801799 X:23071922-23071944 CCTCATAGAATGAGTTAGGAAGG - Intergenic
1188326638 X:28811539-28811561 CCACATGGTCAGATAAAGGAAGG + Intronic
1188644673 X:32551115-32551137 CCTCATAGAATGAGTTAGGAAGG - Intronic
1189037920 X:37511571-37511593 CCTCACAGACAGAAAAATGATGG - Intronic
1189201477 X:39199659-39199681 CCTCATAAACAGAGGAAGTCAGG - Intergenic
1189349969 X:40268776-40268798 CCTCCTAGAGAGAGAAAAGAGGG + Intergenic
1189581340 X:42410210-42410232 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1189965377 X:46367089-46367111 CTTTATAGACAGAGAAGGGCTGG - Intergenic
1191224448 X:58028045-58028067 CCTCATAGAAAGAGTTGGGAAGG + Intergenic
1192143961 X:68668327-68668349 TCTCATAGAAAAAAAAAGGAAGG - Intronic
1192362337 X:70447667-70447689 CAACATAGCCAGAGAAAGGTGGG + Intronic
1192726509 X:73758873-73758895 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1193023552 X:76819800-76819822 CCTCAAATACAATGAAAGGAAGG - Intergenic
1193044816 X:77041179-77041201 CCTCATAGAATGAGTAAGGGAGG - Intergenic
1193259063 X:79383676-79383698 CCTCATAGAATGAGTTAGGAAGG - Intergenic
1193283049 X:79678305-79678327 CCTCATAGAAAGAGTTAGAAAGG - Intergenic
1193552907 X:82920985-82921007 CCTCATAGAGTGAGTTAGGAAGG + Intergenic
1194217203 X:91145590-91145612 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1194633910 X:96320711-96320733 TCCAAAAGACAGAGAAAGGAAGG - Intergenic
1195024197 X:100859445-100859467 CCTCATAGAGTGAGTTAGGAAGG + Intronic
1196010750 X:110885357-110885379 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1197553116 X:127919186-127919208 CCTCATAGAATGAGTAGGGAAGG + Intergenic
1197790640 X:130250735-130250757 CCTCATAGAATGAGTTAGGAAGG - Intronic
1197816415 X:130503338-130503360 AATGATAGAGAGAGAAAGGAGGG - Intergenic
1198302877 X:135348691-135348713 CCAAGGAGACAGAGAAAGGAAGG - Intronic
1198403315 X:136288600-136288622 ACACATAGTCACAGAAAGGAGGG - Intergenic
1199044308 X:143150916-143150938 CCTCATAGGCAAAGAAATAATGG + Intergenic
1199297284 X:146173563-146173585 ACTGATACCCAGAGAAAGGAAGG - Intergenic
1199441570 X:147874523-147874545 TTTCATTTACAGAGAAAGGATGG + Intergenic
1200553720 Y:4609381-4609403 CCTCATAGAATGAGTTAGGAAGG + Intergenic
1201358692 Y:13122846-13122868 CCTCATAGAATGAGTTAGGAAGG + Intergenic