ID: 907116644

View in Genome Browser
Species Human (GRCh38)
Location 1:51974779-51974801
Sequence CACAATTAACACTATGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907116644_907116645 -10 Left 907116644 1:51974779-51974801 CCTACTTCATAGTGTTAATTGTG 0: 1
1: 0
2: 0
3: 18
4: 217
Right 907116645 1:51974792-51974814 GTTAATTGTGAGATAGTATATGG 0: 1
1: 0
2: 2
3: 14
4: 170
907116644_907116646 -9 Left 907116644 1:51974779-51974801 CCTACTTCATAGTGTTAATTGTG 0: 1
1: 0
2: 0
3: 18
4: 217
Right 907116646 1:51974793-51974815 TTAATTGTGAGATAGTATATGGG 0: 1
1: 0
2: 1
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907116644 Original CRISPR CACAATTAACACTATGAAGT AGG (reversed) Intronic
901386164 1:8910739-8910761 AACAATTAAAACAATGAGGTTGG + Intergenic
901819436 1:11817565-11817587 CATATTTAACAATGTGAAGTCGG - Intronic
902488366 1:16762922-16762944 CACATTTAATCCTACGAAGTAGG + Intronic
902997177 1:20235446-20235468 CACATATAAGACTATGCAGTAGG + Intergenic
903125962 1:21247915-21247937 CACAAATAACCCAGTGAAGTGGG - Intronic
903587550 1:24427698-24427720 CACAAACAACACTATGAGATGGG - Intronic
905029643 1:34873275-34873297 CCCAATCATCACAATGAAGTGGG + Intronic
907116644 1:51974779-51974801 CACAATTAACACTATGAAGTAGG - Intronic
908001092 1:59680380-59680402 TTCAATTAAGAATATGAAGTTGG + Intronic
908305956 1:62816265-62816287 CATAATTAACTCTTTGAAGAGGG - Intronic
909581147 1:77236637-77236659 CTCAGATAACTCTATGAAGTAGG - Intergenic
909661577 1:78089333-78089355 CCCAAATAATACTATAAAGTAGG - Intronic
910089632 1:83446911-83446933 CACAAATAATACTATGAGATAGG + Intergenic
910535633 1:88294473-88294495 CACAATTTATTCTATTAAGTTGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911721169 1:101192754-101192776 TACAAACAACCCTATGAAGTAGG + Intergenic
915859359 1:159427436-159427458 CACAAGAAACATTATCAAGTAGG + Intergenic
915990504 1:160511516-160511538 CACATTCAACAGAATGAAGTTGG + Intronic
919002396 1:191849315-191849337 AACAATAAAGACTATGAAGGAGG + Intergenic
920393640 1:205627834-205627856 CACGATTATCACTTTGAAGCTGG + Intronic
921260768 1:213383521-213383543 CCCAATTAATTCTTTGAAGTGGG - Intergenic
921521531 1:216161404-216161426 AAGAATTAATAATATGAAGTAGG - Intronic
921607439 1:217172479-217172501 CACAAAAAACTCTATGAGGTAGG - Intergenic
923532075 1:234819591-234819613 CACATTTAATCCTACGAAGTAGG - Intergenic
924085239 1:240444418-240444440 CACAATACACACTATGAGGCTGG - Intronic
924361664 1:243247811-243247833 CAAATCTAACACTATCAAGTTGG + Intronic
1063089836 10:2853865-2853887 CACAATTCACTTTATGAGGTCGG + Intergenic
1063149993 10:3328118-3328140 CACAATCAAGACTATGATATGGG - Intergenic
1073346989 10:102791024-102791046 GACAATAAAAACTCTGAAGTGGG - Intronic
1073534637 10:104265591-104265613 TACAATGAACAAAATGAAGTTGG - Intronic
1074273412 10:111977546-111977568 CATAATTAAAACTATGAGATTGG + Intergenic
1075592388 10:123702392-123702414 CAGAATTCAATCTATGAAGTCGG - Intergenic
1076006357 10:126950754-126950776 CCATATTAACCCTATGAAGTGGG - Intronic
1077754554 11:5012393-5012415 CACACTTAACAATATTAAGAGGG + Intergenic
1078721170 11:13884540-13884562 CAAAATTTAAACTAGGAAGTGGG - Intergenic
1079084291 11:17434081-17434103 CACATTTAGAACTATGTAGTTGG - Intronic
1079901777 11:26195873-26195895 CACAGTTAACTCTACAAAGTAGG - Intergenic
1081358180 11:42140240-42140262 TACAATTAAAAATATGAAATAGG - Intergenic
1086159605 11:83707020-83707042 CAAAATCAACTCCATGAAGTAGG + Intronic
1086472332 11:87128221-87128243 CACAATTAAGACTAGGAAAAAGG - Intronic
1086626405 11:88960362-88960384 CAAAAAAAAAACTATGAAGTAGG + Intronic
1088340465 11:108759928-108759950 CAAATTCAACACAATGAAGTAGG - Intronic
1088444679 11:109912916-109912938 AACACTTAACACTATGTACTTGG - Intergenic
1088530399 11:110801806-110801828 CACAATTAACACTCAATAGTTGG + Intergenic
1092178612 12:6428755-6428777 CACAAGTAAAAGAATGAAGTTGG + Intergenic
1092595495 12:9999945-9999967 CACACTTAACTTTATGAAATGGG + Intronic
1092707914 12:11304659-11304681 CACAATGAAGACTGGGAAGTTGG + Intergenic
1093159332 12:15727378-15727400 CACAAGTAAAACAATGAATTTGG - Intronic
1093964779 12:25312649-25312671 CCAGATTACCACTATGAAGTCGG + Intergenic
1096563470 12:52454245-52454267 AAAAATAAACACTATAAAGTGGG - Intergenic
1098890543 12:76006097-76006119 AACAACTAACTCTATGAAGTAGG + Intergenic
1099833981 12:87883121-87883143 CACAAGCAAAACTGTGAAGTTGG - Intergenic
1101330554 12:103754454-103754476 CTCAATCAACCCTATGAGGTGGG - Intronic
1102806430 12:115785279-115785301 CTCGATAAACACTATGAAGCAGG + Intergenic
1103210580 12:119163381-119163403 AACAACCAACCCTATGAAGTAGG + Intergenic
1103745644 12:123121425-123121447 CAAAAGGAACACTAAGAAGTAGG - Intronic
1107006408 13:35616633-35616655 GACAATTTAAACTCTGAAGTAGG + Intronic
1107742173 13:43462412-43462434 CAAAATTAACATTTAGAAGTAGG + Intronic
1108492255 13:50993380-50993402 CACACATAAAACTATGAGGTAGG + Intergenic
1109024907 13:57144341-57144363 CACAATGAGCACTGTGCAGTGGG + Intronic
1109025894 13:57150911-57150933 CACAATGAGCACTGTGCAGTGGG + Intronic
1109026884 13:57157484-57157506 CACAATGAGCACTGTGCAGTGGG + Intergenic
1109027876 13:57164055-57164077 CACAATGAGCACTGTGCAGTGGG + Intergenic
1109028862 13:57170620-57170642 CACAATGAGCACTGTGCAGTGGG + Intergenic
1109140066 13:58703885-58703907 CACCATTGACACTATGCAGGCGG + Intergenic
1112203619 13:97302547-97302569 CACAACTAACCCTATGATATTGG + Intronic
1112382615 13:98906508-98906530 CACAGTTAAGTCTATGGAGTCGG + Intronic
1112704903 13:102056550-102056572 CACAAATGAGACCATGAAGTAGG - Intronic
1115369174 14:32592773-32592795 CACAATAAACCCCATGAAGTAGG + Intronic
1116204683 14:41848613-41848635 GACAAGAAACACTATGAATTGGG + Intronic
1116400642 14:44502557-44502579 CACAATGAAAACAATGAAGATGG - Intergenic
1117707007 14:58480724-58480746 AACAATAAACTCTATGAAGCTGG - Intronic
1119431133 14:74568646-74568668 CACCATTAAAATTAGGAAGTAGG + Intronic
1120879831 14:89406580-89406602 CTCACTAAACCCTATGAAGTAGG - Intronic
1120886330 14:89454826-89454848 GACAATTAACAACATGAAGATGG - Intronic
1124952764 15:34338411-34338433 AAAAATTAAAACTATAAAGTAGG + Intergenic
1125840686 15:42798592-42798614 TACAATGAACACAAAGAAGTTGG + Intronic
1126139065 15:45422089-45422111 CAAAATTAACATTATCAAGAAGG - Intergenic
1126154692 15:45554649-45554671 CACAATTAAAACTATGCATAAGG - Intergenic
1127783628 15:62337333-62337355 CACTTTTAAGACTATGAAGTAGG - Intergenic
1132324648 15:100958737-100958759 CACAATAACCCCTCTGAAGTAGG + Intronic
1137819723 16:51432489-51432511 CTCATTCAACTCTATGAAGTAGG + Intergenic
1138877414 16:60969247-60969269 CACAACTTACATTTTGAAGTTGG - Intergenic
1139191975 16:64874899-64874921 CACAATTATCCTTAGGAAGTGGG + Intergenic
1139744679 16:69064743-69064765 CTCATTTAACCCTATGAAGCAGG - Intronic
1141186839 16:81793665-81793687 CACTATTATCATTATTAAGTGGG - Intronic
1141924601 16:87159883-87159905 AACAATTTATCCTATGAAGTGGG - Intronic
1149067887 17:52502042-52502064 CTCACAGAACACTATGAAGTAGG + Intergenic
1150746960 17:67824656-67824678 AACATTTAACACCGTGAAGTAGG + Intergenic
1150791622 17:68204686-68204708 AACATTTAACACCGTGAAGTAGG + Intergenic
1150867372 17:68867528-68867550 CACAGGTAACACCATGATGTAGG - Exonic
1153972795 18:10241700-10241722 CAGAAATCACACTATGAAGGTGG + Intergenic
1156617784 18:38808315-38808337 CACAAATAATACTATGATATAGG + Intergenic
1162248006 19:9418962-9418984 CAAAATAAAAACTATGCAGTTGG + Exonic
1202702832 1_KI270713v1_random:1318-1340 CACATTTAATCCTACGAAGTAGG - Intergenic
925476148 2:4217707-4217729 CACAACTACCTCTATGAAGTAGG + Intergenic
928304683 2:30158075-30158097 GACAATGAACACAATGAAGTGGG - Intronic
929377903 2:41312944-41312966 CATATTTCACACCATGAAGTTGG + Intergenic
930413582 2:51059493-51059515 TACATTTAACACTATGTAGTTGG + Intergenic
930904357 2:56548172-56548194 CACAATTCACACTATGAATATGG + Intergenic
931325558 2:61218463-61218485 CACAGTTAACACTATTATGATGG + Intronic
934722561 2:96591459-96591481 CAAAATTAAAACCAGGAAGTTGG - Intergenic
936882768 2:117274516-117274538 CACAAGCAACAGAATGAAGTTGG - Intergenic
937500703 2:122475537-122475559 CACAATGAACACTGTGAAGATGG - Intergenic
939895865 2:147790854-147790876 CATCAACAACACTATGAAGTAGG + Intergenic
942409300 2:175691408-175691430 CACATATAACTCTATAAAGTAGG - Intergenic
942599056 2:177621354-177621376 CACAAATCACACTGTGAAATTGG + Intergenic
943673724 2:190695330-190695352 CACAATCAAGACACTGAAGTGGG + Intergenic
946683429 2:222241858-222241880 AATAATTAACTCTATGAAATAGG + Intronic
947422976 2:229957274-229957296 CAGAAATCAAACTATGAAGTAGG + Intronic
947744709 2:232501610-232501632 CTCCAATAACCCTATGAAGTTGG + Intergenic
948082555 2:235218660-235218682 CACAAACAACCCTATGAAGCTGG - Intergenic
1168741492 20:195230-195252 CACAATAAGAACTAAGAAGTTGG + Intergenic
1168856118 20:1010284-1010306 CACAAACAATCCTATGAAGTAGG - Intergenic
1169043142 20:2512608-2512630 CACAAGTAAAAGAATGAAGTTGG + Intronic
1169918475 20:10707234-10707256 CACAATTTGGACTATGAAGCTGG + Intergenic
1170347014 20:15398693-15398715 CACAACCAACACAATGAAGACGG - Intronic
1170983657 20:21238692-21238714 CAGAATAAACACCATGAAATTGG - Intronic
1171566534 20:26196789-26196811 CACAGTTAACACAATCAAGATGG - Intergenic
1174613930 20:51821447-51821469 CACAATCAAGAATATGATGTAGG - Intergenic
1175999935 20:62827192-62827214 CAGAGTTAACACCATGGAGTTGG - Intronic
1176658989 21:9616104-9616126 AACAATAAACACAATAAAGTGGG + Intergenic
1183805364 22:40205157-40205179 GACAATTTTCACTATGAGGTGGG - Intronic
1185042849 22:48514393-48514415 CAAAATTAAATCTATGAAGAAGG - Intronic
949793209 3:7816461-7816483 CATTATTAACACTATGTTGTAGG + Intergenic
950923703 3:16719299-16719321 CACAATAACCTCTATGAGGTTGG - Intergenic
951856923 3:27207657-27207679 CAGAATTAACACATTGCAGTGGG - Intronic
951942724 3:28098326-28098348 GACAATTAACATTACAAAGTAGG - Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955424453 3:58773248-58773270 CACCATTAAAAATATGAATTTGG + Intronic
957015082 3:75053765-75053787 CACAATGAACACTAAAAATTTGG + Intergenic
957642734 3:82878571-82878593 CACAAATAACACTGTGATCTTGG + Intergenic
957795682 3:85003287-85003309 AACAAGTAACAATCTGAAGTAGG - Intronic
959207276 3:103325784-103325806 CAAAATTAACAATGAGAAGTTGG - Intergenic
960704473 3:120468862-120468884 CCAAAGTAACACTATGAGGTCGG - Intergenic
961050722 3:123743997-123744019 CTCAAAAAACACTTTGAAGTTGG - Intronic
962294935 3:134175024-134175046 CACTATTAACACTAGGAGATAGG - Intronic
963649770 3:147963722-147963744 AACCATTAACAATATGATGTAGG - Intergenic
963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG + Intergenic
964797762 3:160518470-160518492 CACAAGTAAAATAATGAAGTTGG - Intronic
967640402 3:191855908-191855930 TCTAATTAAAACTATGAAGTGGG - Intergenic
967886068 3:194334378-194334400 CACCAATAACACTATGAGGTGGG + Intergenic
973950634 4:56009805-56009827 CACAAAGAACTCGATGAAGTAGG + Exonic
974258605 4:59495240-59495262 CACTATTAAGAATCTGAAGTAGG + Intergenic
974986359 4:69031153-69031175 CACAAAACACAATATGAAGTGGG - Intronic
975294554 4:72717731-72717753 GACAAATAAGACTAAGAAGTAGG - Intergenic
976475943 4:85483056-85483078 TCACATTAACACTATGAAGTAGG - Intronic
976548774 4:86369485-86369507 CAGAATTAATAATATGAATTTGG + Intronic
977439085 4:97038669-97038691 CATATTTAAGACTAAGAAGTAGG - Intergenic
977827439 4:101550460-101550482 CAAAACAAACAGTATGAAGTAGG + Intronic
980400493 4:132277882-132277904 CACAAATAACTTAATGAAGTAGG - Intergenic
980639524 4:135558062-135558084 CAAAATAAACTCTATGGAGTTGG + Intergenic
981246427 4:142545331-142545353 TGCAATTAACCCTATGAGGTAGG + Intronic
981612104 4:146604808-146604830 CCCAGTAAATACTATGAAGTAGG - Intergenic
983236189 4:165182051-165182073 CACAACTCACACTATAAAGAAGG + Intronic
983676624 4:170302160-170302182 CTCAAATAATTCTATGAAGTAGG - Intergenic
983738591 4:171096073-171096095 CAAAAGTAACCTTATGAAGTGGG + Intergenic
984046970 4:174813588-174813610 CACAATTATATCTTTGAAGTGGG - Intronic
984111237 4:175617442-175617464 CACGATTAAGACTAAAAAGTGGG + Intergenic
984165931 4:176303293-176303315 CACTATTGTCACCATGAAGTAGG + Intergenic
985416337 4:189739329-189739351 AACAATAAACACAATAAAGTGGG - Intergenic
987161607 5:15150277-15150299 CTGAAATAAAACTATGAAGTGGG + Intergenic
987199669 5:15563318-15563340 CGCAATTAACGTGATGAAGTAGG - Intronic
987556770 5:19462120-19462142 GGCAATTAACACTCTGAAGGAGG + Intergenic
988717633 5:33843620-33843642 CAGAATGAATACTATGATGTTGG + Intronic
990964155 5:61426929-61426951 CACAATTAACACTACCAATAAGG - Intronic
991650352 5:68846366-68846388 CACAATTTACATTAAAAAGTTGG - Intergenic
992300426 5:75372931-75372953 CACAATGAAGATTTTGAAGTGGG + Exonic
992560889 5:77951762-77951784 AGCAATTAACTCTATGAAGTTGG + Intergenic
993981080 5:94544416-94544438 CAAAAATAACAGAATGAAGTAGG - Intronic
995735744 5:115297578-115297600 CACAAATAACTTCATGAAGTAGG + Intergenic
996981892 5:129506924-129506946 TCCAAATAACCCTATGAAGTTGG + Intronic
997913261 5:137897516-137897538 CAAAATTAACACTATCAATTAGG + Intronic
998633054 5:143922107-143922129 CAGAATGAACACTGTGAAGTAGG - Intergenic
999015939 5:148105457-148105479 CCCAATTAAGATTATTAAGTTGG + Intronic
999242206 5:150134350-150134372 CACAATTGATCCTATGAGGTAGG + Intronic
999942853 5:156563289-156563311 CATTATTAACACTCTTAAGTAGG + Intronic
1000086341 5:157890668-157890690 CACTGTTAACACTATGAAGAAGG - Intergenic
1001039864 5:168326517-168326539 AACAAATAACACTATCAAGTCGG - Intronic
1007918576 6:45585826-45585848 CTCAAACAACCCTATGAAGTAGG + Intronic
1009296069 6:61949139-61949161 CATAATTACCACTATTCAGTGGG - Intronic
1009502154 6:64427800-64427822 AAGAAGTAACACAATGAAGTAGG + Intronic
1009803767 6:68575637-68575659 CACAGTTAACAATATGACCTAGG + Intergenic
1011567150 6:88688278-88688300 CAGAATTAACATTTTGATGTTGG + Intronic
1011856837 6:91703534-91703556 CACAAATCTCACCATGAAGTTGG + Intergenic
1013209124 6:107971166-107971188 CTCAACTATCCCTATGAAGTAGG + Intergenic
1013296641 6:108763674-108763696 CTCAATTAAGACTATAAAGAAGG - Intergenic
1013822011 6:114165840-114165862 CTCAAATAACTCTATGAAGTAGG - Intronic
1015392588 6:132699759-132699781 CAAAATAAACAAAATGAAGTTGG + Intronic
1015501768 6:133941924-133941946 CATACTTAACTCTATTAAGTTGG - Intergenic
1016388924 6:143555748-143555770 GACAATTCACACGATGAGGTAGG - Intronic
1018264874 6:162013586-162013608 CACAGTTATCACTATGCACTTGG - Intronic
1018266624 6:162031061-162031083 CATAAGTAACACTTTGATGTTGG + Intronic
1019009841 6:168835375-168835397 TACAATTAAAATTATGAATTAGG + Intergenic
1019914932 7:4126852-4126874 CACAATGATCCCAATGAAGTAGG - Intronic
1020735088 7:11938473-11938495 CACAGTTATCAATATGAAATAGG + Intergenic
1023506746 7:40907555-40907577 CACAAAAGACCCTATGAAGTAGG + Intergenic
1024149499 7:46556066-46556088 CACAAATCACACTATTAAGATGG + Intergenic
1027306492 7:76903348-76903370 CACAAATAATACTATGAGATAGG + Intergenic
1028717673 7:93991683-93991705 CACCATTCACACTATGACTTTGG - Intronic
1029010552 7:97257384-97257406 GACATTTAACATTATTAAGTGGG + Intergenic
1031780624 7:125958272-125958294 AAAAATTAAAACTATGCAGTGGG - Intergenic
1032211416 7:129917718-129917740 CACAATTAAAACTTTGAACTGGG + Intronic
1032436151 7:131901920-131901942 CAAAATTAAAACTAAGAAATAGG + Intergenic
1033823357 7:145160349-145160371 CACAGTTTATATTATGAAGTTGG + Intergenic
1034074693 7:148220400-148220422 CATAGTTAACATTATGATGTTGG - Intronic
1037006040 8:13781310-13781332 CACAATAAACTTTATGAAATGGG - Intergenic
1039249730 8:35649556-35649578 TTCAATCAACACTATGAAGATGG + Intronic
1039491687 8:37952608-37952630 CACTTTTAAGACCATGAAGTTGG - Intergenic
1040727643 8:50401968-50401990 CAAAATTCACACAAAGAAGTGGG - Intronic
1041486290 8:58380916-58380938 CACAATCCCCACTGTGAAGTTGG - Intergenic
1041625829 8:60025567-60025589 CACAAATAAACCCATGAAGTGGG - Intergenic
1041941836 8:63397267-63397289 CTCAATTACCACTCAGAAGTTGG - Intergenic
1043022799 8:75025115-75025137 GATAATTAAAACTATGAAATTGG + Intronic
1043259713 8:78181095-78181117 GACATTTAACAATATGAACTGGG - Intergenic
1043764623 8:84114780-84114802 TATAAATAACACTATGAAGTAGG + Intergenic
1043969907 8:86517233-86517255 CACATTTACCAATATGAATTAGG + Intronic
1045626276 8:104055470-104055492 GTCAATTAACACAATGAATTTGG + Intronic
1046847954 8:118939720-118939742 GACAATTAAAACTATGTATTGGG + Intronic
1047310955 8:123691559-123691581 CCTTATTAACCCTATGAAGTAGG + Intronic
1051683527 9:19632752-19632774 CATCATTAAAACTAGGAAGTTGG + Intronic
1055325370 9:75122738-75122760 CACCAAGAACACTATGAAGTGGG - Intronic
1056210676 9:84362066-84362088 CACAAAAAACACTAATAAGTCGG - Intergenic
1057941071 9:99285047-99285069 CACAATTAACAATATACATTGGG - Intergenic
1059025172 9:110619715-110619737 TTCAATTAACACTTTAAAGTAGG - Intergenic
1060574200 9:124674353-124674375 AGCAATTAACGCTATGAAGCTGG + Intronic
1061527802 9:131182006-131182028 CACATTCAAAACAATGAAGTTGG - Intronic
1203636734 Un_KI270750v1:119712-119734 AACAATAAACACAATAAAGTGGG + Intergenic
1188055851 X:25540621-25540643 CATAAATAATAATATGAAGTAGG + Intergenic
1190032539 X:46988292-46988314 CTCCAGTAACACTATAAAGTAGG + Intronic
1191920602 X:66252898-66252920 CACATGCAAAACTATGAAGTTGG + Intronic
1192281300 X:69688948-69688970 CACAAGTAAAAGAATGAAGTTGG - Intronic
1192578197 X:72259571-72259593 CACAACAAAACCTATGAAGTTGG + Intronic
1198315152 X:135458016-135458038 CACATGTAAAACTATAAAGTTGG - Intergenic
1202015371 Y:20400826-20400848 CACAATTAAGGTTATTAAGTTGG - Intergenic
1202113447 Y:21448266-21448288 AACAAATTACACTATTAAGTGGG - Intergenic