ID: 907117882

View in Genome Browser
Species Human (GRCh38)
Location 1:51985757-51985779
Sequence TAGCTGTGACTGCCACAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907117879_907117882 15 Left 907117879 1:51985719-51985741 CCTCGTGTAGAATCAGTGAGAAA 0: 1
1: 0
2: 1
3: 13
4: 159
Right 907117882 1:51985757-51985779 TAGCTGTGACTGCCACAGATAGG 0: 1
1: 1
2: 2
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907117882 Original CRISPR TAGCTGTGACTGCCACAGAT AGG Intronic
907117882 1:51985757-51985779 TAGCTGTGACTGCCACAGATAGG + Intronic
907872169 1:58453485-58453507 TAGTTGAGATTGCTACAGATAGG - Intronic
908609951 1:65846601-65846623 TAGCTGTGAATGAAACAGAGGGG + Intronic
911538774 1:99133199-99133221 GAGTAGTGACTGCCACAAATAGG + Intergenic
918578550 1:186096530-186096552 TAGATGTGACTTCCATAGAATGG + Intronic
919799322 1:201343829-201343851 TATCAGTGACTGCAACAGAAGGG + Intergenic
920205724 1:204289674-204289696 TAGCTGTGACTGTAAAGGATGGG - Intronic
921353234 1:214259419-214259441 AAGCTGTCATTCCCACAGATAGG - Intergenic
923397823 1:233584408-233584430 TAGCTTTGCCATCCACAGATGGG - Intergenic
924457153 1:244228021-244228043 CAGCTGAGCCTGGCACAGATAGG - Intergenic
1064122639 10:12633184-12633206 TAGTTGTGGCTGCCACACTTTGG + Intronic
1067056603 10:43056252-43056274 GAGCTGTGTCTGTCACACATGGG - Intergenic
1068627724 10:59267477-59267499 TAGCTGTGACTGCCTGACTTTGG + Intronic
1069010459 10:63366114-63366136 TAGCTGTGACCTCCAGAGAAAGG + Intronic
1069451710 10:68523218-68523240 TAGCTGGGACTACAACAGGTGGG + Intronic
1073435255 10:103512429-103512451 TGGCTCTGCCAGCCACAGATAGG + Intronic
1074717755 10:116235531-116235553 TGCCTGTGACTGCCCCACATTGG + Intronic
1085736679 11:79045236-79045258 TACCTGTGCCTCCCACAGAGAGG - Intronic
1088781795 11:113142093-113142115 TAACTGTGACTACCACTTATTGG + Intronic
1090446511 11:126769153-126769175 AAGCAGTGACTGGCAGAGATGGG - Intronic
1090812509 11:130258549-130258571 TAGCAGTGTCTGCCACAAGTAGG - Intronic
1092142503 12:6193583-6193605 TAGGGGTGGCTGCCACAGATTGG + Intergenic
1093376110 12:18429846-18429868 TAGCAGTCACTGCAGCAGATGGG - Intronic
1096737761 12:53669210-53669232 GAGCTGGGGCTGCCACAGTTGGG - Exonic
1098389501 12:69954115-69954137 TAGCTGTATCTGCCACTTATAGG - Intronic
1101902810 12:108803684-108803706 TTGCTGTGACTGCCACCTAGTGG + Intronic
1103161643 12:118734186-118734208 GAGCTCTGAGTGCCACAGGTGGG + Intergenic
1105743575 13:23354895-23354917 TAGCTGTGACTGGGTCAGGTTGG - Exonic
1107422164 13:40257559-40257581 TACCTGTGAATGCCACAGATAGG + Intergenic
1107811888 13:44208391-44208413 TGGCTGTCACAGCCACAGACAGG + Intergenic
1112873630 13:104007010-104007032 TAGGTCTGTCTGCCTCAGATAGG + Intergenic
1113401985 13:110002650-110002672 TAGCTGTGAGTGCCCCACAGAGG + Intergenic
1115630973 14:35245021-35245043 TAGCTCTGACTTCCCCAGAAGGG - Intronic
1115730548 14:36264592-36264614 TAGCAGTGTCTGCCACAAAATGG - Intergenic
1116461763 14:45184801-45184823 TCGCTGTTACTGCCACAGACTGG + Intronic
1117445429 14:55799655-55799677 AAGCTCTGTCTGCCATAGATAGG + Intergenic
1117668133 14:58078472-58078494 CAGCAGTGACTGCTACAGAAGGG - Intronic
1118744084 14:68761584-68761606 CAGATGTGCCTGCCACAGGTGGG + Intergenic
1119208374 14:72811533-72811555 TGGCTGTAAGTGCCACAGACTGG - Intronic
1120487386 14:85131138-85131160 AAGCTGTGACTGACAGAGACAGG - Intergenic
1125256095 15:37764852-37764874 TAGATGGCACTGCCACAAATTGG + Intergenic
1128032889 15:64497507-64497529 GATCTGTAAATGCCACAGATAGG - Intronic
1130443723 15:83979187-83979209 TAGCAGTGGCTGCTACAGATCGG - Intronic
1132146655 15:99433375-99433397 TAGCTGTCCCCGCCACAGCTGGG + Intergenic
1141234460 16:82202802-82202824 GAGCTGTGAGTGCCCCTGATTGG + Intergenic
1142057828 16:88011097-88011119 TGGCTCTGAGTGCCACAGAGCGG + Intronic
1145000848 17:19303575-19303597 TTGCTGGGACTGTCATAGATGGG + Intronic
1146794528 17:35772040-35772062 CAACTGTGACTGGCAAAGATGGG + Intronic
1146957984 17:36948107-36948129 TAGCAGTGCCTGCCACATAGTGG + Intergenic
1149676313 17:58465749-58465771 ATGCTGTAACTGCCAAAGATTGG - Intronic
1151241132 17:72758767-72758789 CAGCTGTGGCTTCCACAGGTGGG - Intronic
1152103872 17:78317891-78317913 TAGCTGTGGCTGCCAGAGGAGGG + Intergenic
1152836200 17:82533827-82533849 TAGCTGGGCCTGGCACAGCTAGG + Intronic
1153500304 18:5742448-5742470 TATGTGTGGCTGCCACAGATTGG + Intergenic
1153736464 18:8074186-8074208 TTGCTAAGACTACCACAGATTGG - Intronic
1158950583 18:62491177-62491199 TAGCTGTGCTGGCCACTGATTGG - Intergenic
1160266194 18:77342264-77342286 CAGCTGTGCCTGCCCCAGGTCGG + Intergenic
1160347824 18:78149195-78149217 TAGCTGTGAAAGCCCTAGATAGG + Intergenic
1160688977 19:452010-452032 TTCCTGTGACAGCCACAGACGGG - Intronic
1160837181 19:1130228-1130250 CAGCCGTGACAGCCACAGACGGG + Intronic
1160862753 19:1244647-1244669 GAGCTGTGGCTGCCACCCATGGG + Exonic
1161246659 19:3256324-3256346 TGGCTCTGACTCCCCCAGATTGG + Intronic
1167714592 19:51134047-51134069 TAACAGTGACTGCCTCAGGTTGG + Intronic
1167894872 19:52572639-52572661 TAGCTGTGACATCCTCAGAACGG - Intronic
925278477 2:2667043-2667065 CAGCTTTCACTGCCACAGGTGGG - Intergenic
925465269 2:4102416-4102438 CAGCTGTTTATGCCACAGATTGG + Intergenic
927202531 2:20587376-20587398 TTGCTCTCCCTGCCACAGATGGG - Intronic
929943898 2:46356080-46356102 CAGATGGGACTGGCACAGATAGG - Intronic
930988443 2:57619400-57619422 TAACTATGACTCCCACAGAATGG - Intergenic
936385885 2:112028696-112028718 CAGCTGTGACTGCAGCAGAGGGG - Exonic
936532782 2:113288503-113288525 TAGCTGTGCCTGCCCCTCATTGG + Intergenic
937142072 2:119610644-119610666 TAGCTCTGATTGGCACATATTGG - Intronic
937656410 2:124381768-124381790 TGGCTGTAACTACCACTGATAGG - Intronic
942300954 2:174562046-174562068 AAGCTCGGACTGCCAAAGATTGG + Exonic
948518334 2:238520112-238520134 TTGCTGTGACTCCCAGAGAGAGG + Intergenic
1173554607 20:43956686-43956708 TAGCTGTGTCTGCCTAAGAGTGG + Intronic
1175821589 20:61913075-61913097 TATCTCTGACTCCCACAGCTCGG + Intronic
1175983685 20:62753878-62753900 TGGCTGTGACTTCCCCAGATGGG - Intronic
1179569829 21:42272193-42272215 TAGATGTGACTGTCACAGGCAGG - Intronic
1182551974 22:31105465-31105487 TAGTGATGACTGCCACAGAATGG - Intronic
1182709261 22:32310448-32310470 CAGCTGTGGCTGCCCCAGCTGGG + Intergenic
1184987436 22:48145333-48145355 CAGCTGTGACTGGCAGAGTTTGG - Intergenic
950052699 3:10004384-10004406 TTTCTTTGATTGCCACAGATAGG - Intronic
952003871 3:28819664-28819686 TAGCTGTAACTGACAAGGATAGG - Intergenic
952111840 3:30133182-30133204 TCACTGTGGGTGCCACAGATCGG - Intergenic
953602926 3:44386345-44386367 TAGCAGTGGCTGCTCCAGATGGG - Intronic
955715169 3:61821838-61821860 TAACTGTGACTACCACATAAAGG - Intronic
956623484 3:71244596-71244618 CTGTTGTGGCTGCCACAGATCGG + Intronic
961418900 3:126784110-126784132 TAGATGTGCTTGCCACAAATAGG + Intronic
963450967 3:145481572-145481594 TAACAGTGACTGCCTCAGGTTGG + Intergenic
968539604 4:1157989-1158011 AAGCTATAGCTGCCACAGATAGG - Intergenic
974713661 4:65637313-65637335 TTGCTGTCATTGTCACAGATTGG + Intronic
975856205 4:78627332-78627354 CAGCTCTGCCTTCCACAGATTGG + Intergenic
977917072 4:102606406-102606428 TAGCTGTTACTGCAATAGGTGGG - Intronic
979167853 4:117558971-117558993 CAGGTGTGTCTGCGACAGATGGG + Intergenic
980639394 4:135555922-135555944 TAACTGGGCCTGCAACAGATTGG - Intergenic
980828432 4:138100117-138100139 TACCAGTGACTGCCACACACCGG - Intergenic
986746909 5:10753152-10753174 GAGCGGTGCCTGCCACAGAGTGG - Intronic
986926691 5:12762695-12762717 TATCTGTGATTTCAACAGATTGG + Intergenic
993415952 5:87631250-87631272 GACCTGTGAGGGCCACAGATGGG + Intergenic
996613482 5:125412161-125412183 CACCTGTGACTGTCACAGGTAGG - Intergenic
998295875 5:140968076-140968098 TCACGGTGACAGCCACAGATGGG + Exonic
998340602 5:141414446-141414468 TCACAGTGACAGCCACAGATGGG + Exonic
999240936 5:150127010-150127032 TTGCTGGGGCTGCCACAGCTCGG + Intronic
999436492 5:151567477-151567499 TGGCTGTGACTGCCACTGACCGG - Exonic
1003313180 6:4986924-4986946 TGAATGTGACTGCCAGAGATGGG + Intergenic
1003992450 6:11499454-11499476 TAGCTGGGTCTGGCACAGAGTGG - Intergenic
1004813269 6:19283979-19284001 TAGCTGTGACTTTCTCAGGTAGG - Intergenic
1006947350 6:37793594-37793616 TAGCAGTCTTTGCCACAGATAGG - Intergenic
1007621128 6:43215289-43215311 TCGCTCTGGCTGCCACAGAAAGG - Exonic
1009350165 6:62665311-62665333 TAGCAGTGTCCGCCAGAGATAGG + Intergenic
1011759460 6:90545684-90545706 TAGCTGTGTCTGCCACAGATGGG - Intronic
1012125967 6:95428480-95428502 TAGCAGTGGCTGGCACAGCTGGG - Intergenic
1012921668 6:105226462-105226484 AAGCTGTGACTGCCACATTCAGG + Intergenic
1012936258 6:105370840-105370862 GATCAGTGACTGCCAAAGATTGG + Intronic
1016778356 6:147930863-147930885 TAGCTGTGCCTGCAGCCGATTGG + Intergenic
1019618143 7:1975867-1975889 TAGCAGGCACTGGCACAGATAGG + Intronic
1020703883 7:11517924-11517946 GAGTTGTGAGTGCCACAGATAGG + Intronic
1020839149 7:13193298-13193320 TAGCTGTGCCTGGGACAGAGAGG - Intergenic
1028446646 7:90932132-90932154 CAGCTGTGAATGCCTCAGACAGG - Intronic
1032303224 7:130709122-130709144 TTGCTGAGACTGCCACAGTGGGG - Intergenic
1035817602 8:2557840-2557862 GAGCATTGTCTGCCACAGATGGG - Intergenic
1039129977 8:34252190-34252212 TAGAAGTGACAGCCAAAGATGGG + Intergenic
1039475275 8:37836340-37836362 GAGGTGGGACTGACACAGATGGG + Intronic
1042937917 8:74079111-74079133 TAGCTGGGCCTTCAACAGATTGG - Intergenic
1043304047 8:78771815-78771837 TAGCAGTGGCTGCAACAGAAAGG - Intronic
1047247142 8:123155865-123155887 TAGCTGTGACTTTCACTGGTAGG - Intergenic
1058199063 9:102016025-102016047 TATCAGTGACTGCCACAGATAGG + Intergenic
1060388795 9:123259885-123259907 TAGCTGTGTTTGGCACAAATAGG - Intronic
1060528127 9:124331998-124332020 GACCTGTGACTGCCACCGAGGGG - Intronic
1060898683 9:127238290-127238312 TAGCTGTGGCAGCCACAGCCAGG - Intronic
1060898684 9:127238292-127238314 TGGCTGTGGCTGCCACAGCTAGG + Intronic
1061238815 9:129357619-129357641 TGCCTGTGAATGCCACAGTTTGG + Intergenic
1061946082 9:133908746-133908768 TAGCTGCGTCTGCCTCAGAGGGG - Intronic
1062250217 9:135590084-135590106 GAGCTGTCCCTGCCACACATAGG + Intergenic
1062425186 9:136502995-136503017 CAGCTGTGACCGCCGCAGGTGGG + Intronic
1193285796 X:79713487-79713509 TATCTGAGACTGCCTCAGCTTGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1194409988 X:93545464-93545486 GAACTGTGACTGCCACATAGAGG - Intergenic
1196606511 X:117663299-117663321 TAGATTTGACTGCCACATCTTGG + Intergenic
1197612707 X:128657054-128657076 TGGCTGTGACTGGCAGAGACCGG + Intergenic
1197721421 X:129747357-129747379 TAACACTGACTGCCACAAATTGG - Intronic
1198652948 X:138883750-138883772 TGGCTGTGATTCCCACAGAGTGG - Intronic
1199449018 X:147958815-147958837 TAGAGGTCACTGCCTCAGATGGG - Intergenic