ID: 907118878

View in Genome Browser
Species Human (GRCh38)
Location 1:51991409-51991431
Sequence TGCCATACTCCTGGTGACTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907118871_907118878 6 Left 907118871 1:51991380-51991402 CCCATGGTCATCCTAACTAGCCC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 907118878 1:51991409-51991431 TGCCATACTCCTGGTGACTTCGG 0: 1
1: 0
2: 2
3: 15
4: 126
907118872_907118878 5 Left 907118872 1:51991381-51991403 CCATGGTCATCCTAACTAGCCCC 0: 1
1: 0
2: 0
3: 8
4: 64
Right 907118878 1:51991409-51991431 TGCCATACTCCTGGTGACTTCGG 0: 1
1: 0
2: 2
3: 15
4: 126
907118868_907118878 13 Left 907118868 1:51991373-51991395 CCCCTGGCCCATGGTCATCCTAA 0: 1
1: 0
2: 2
3: 7
4: 131
Right 907118878 1:51991409-51991431 TGCCATACTCCTGGTGACTTCGG 0: 1
1: 0
2: 2
3: 15
4: 126
907118873_907118878 -5 Left 907118873 1:51991391-51991413 CCTAACTAGCCCCTGTTCTGCCA 0: 1
1: 0
2: 1
3: 7
4: 153
Right 907118878 1:51991409-51991431 TGCCATACTCCTGGTGACTTCGG 0: 1
1: 0
2: 2
3: 15
4: 126
907118870_907118878 11 Left 907118870 1:51991375-51991397 CCTGGCCCATGGTCATCCTAACT 0: 1
1: 0
2: 1
3: 11
4: 133
Right 907118878 1:51991409-51991431 TGCCATACTCCTGGTGACTTCGG 0: 1
1: 0
2: 2
3: 15
4: 126
907118869_907118878 12 Left 907118869 1:51991374-51991396 CCCTGGCCCATGGTCATCCTAAC 0: 1
1: 0
2: 2
3: 4
4: 118
Right 907118878 1:51991409-51991431 TGCCATACTCCTGGTGACTTCGG 0: 1
1: 0
2: 2
3: 15
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907118878 Original CRISPR TGCCATACTCCTGGTGACTT CGG Intergenic
900160966 1:1223641-1223663 TGCCAGAATCCTGGTGACAGAGG - Intronic
900590205 1:3456071-3456093 TCCCACCCTCCAGGTGACTTTGG - Intronic
902746990 1:18481059-18481081 TGCCCTGCTCCTGGTGACTGTGG + Exonic
903126639 1:21252728-21252750 TCCCATACTCCAGGTAACTTAGG - Intronic
904831867 1:33310677-33310699 TGCTCTATTCCTGGTGACTGTGG + Intronic
907118878 1:51991409-51991431 TGCCATACTCCTGGTGACTTCGG + Intergenic
911054739 1:93700115-93700137 TGGCATACTCCTGGAGTCTTGGG - Intronic
913594274 1:120358714-120358736 TTCCTTGCTGCTGGTGACTTTGG - Intergenic
914092986 1:144520270-144520292 TTCCTTGCTGCTGGTGACTTTGG + Intergenic
914225085 1:145713512-145713534 TGCCATCCTCATGCTGACTTGGG - Intergenic
914305541 1:146413602-146413624 TTCCTTGCTGCTGGTGACTTTGG - Intergenic
914596516 1:149159204-149159226 TTCCTTGCTGCTGGTGACTTTGG + Intergenic
918811728 1:189131072-189131094 TGCCATTGTCCAGGTGAGTTTGG + Intergenic
919659896 1:200234111-200234133 TGCCATTCCCCTGGTAACTTGGG + Intergenic
921382865 1:214542912-214542934 TGCCTTAATCCCGTTGACTTAGG + Intronic
922961128 1:229646423-229646445 ACCTATAATCCTGGTGACTTGGG - Intronic
923981719 1:239331854-239331876 TCCCATACTCAAGGTCACTTAGG - Intergenic
1063954759 10:11255708-11255730 TGACATACTCGGGGTGACTGGGG - Intronic
1064228946 10:13512867-13512889 TGCCATTCTCCAGGTCCCTTGGG - Intronic
1064239674 10:13614855-13614877 TGCTCTACTCCTAGTGCCTTGGG - Intronic
1067004573 10:42648670-42648692 ACCCAGACTCCTGGTAACTTAGG - Intergenic
1068822929 10:61398901-61398923 TCACATACTCCTGGAGCCTTTGG - Intergenic
1068854273 10:61781562-61781584 TGCAATTCTCGTGGAGACTTTGG - Intergenic
1069566101 10:69464461-69464483 TGCCCTACTGCTGGTTTCTTGGG + Intronic
1073124335 10:101140329-101140351 TGCCAGACTCCTGGGGACGCTGG + Intergenic
1074936116 10:118182978-118183000 TAACATTCTCGTGGTGACTTAGG - Intergenic
1077264063 11:1640357-1640379 TGCCAGACACCTGGCGCCTTGGG - Intergenic
1080259929 11:30337730-30337752 TGCCATACTCCTTCTAAGTTTGG - Exonic
1081606275 11:44529056-44529078 TGCCCTCCTTCTGGTGACCTTGG + Intergenic
1081622454 11:44626664-44626686 TGCAAAACTCCTTGAGACTTAGG - Intergenic
1085062138 11:73457126-73457148 TCCTATAATCCTAGTGACTTGGG + Intronic
1085463228 11:76707633-76707655 TGCCACCCTCCTGATGATTTCGG + Intergenic
1085765262 11:79276738-79276760 TGCCATACTCCTTGCTGCTTTGG + Intronic
1087831176 11:102821215-102821237 TGCCATATCCATGGGGACTTTGG + Intergenic
1089055663 11:115582864-115582886 TGGCATACTTCTGGGGTCTTGGG + Intergenic
1089981078 11:122773109-122773131 TGCTATCCTCCGGGTGACTCAGG - Intronic
1101331675 12:103762312-103762334 TGCCATCATCCTGGTGACTGGGG + Exonic
1102427906 12:112858843-112858865 GGACATACTCCTGGTGCCTCTGG + Intronic
1104788497 12:131467064-131467086 TCCCATCCTCCTGTTGACTGAGG - Intergenic
1105498787 13:20953364-20953386 TGCCACACCCCTGGTGTCCTTGG - Intergenic
1105943292 13:25170180-25170202 TTCCACACACCTGGTGTCTTTGG + Exonic
1108004401 13:45932788-45932810 GTCCATACTCATTGTGACTTTGG + Intergenic
1108211291 13:48142240-48142262 TGACCTACTCCTAGTGACCTGGG - Intergenic
1108736152 13:53285045-53285067 TCACAGTCTCCTGGTGACTTAGG + Intergenic
1114581723 14:23766986-23767008 TGCCATATTCATGGAGACTGTGG - Intergenic
1125536828 15:40445829-40445851 TGCCATTGTGCTGGGGACTTTGG + Intronic
1126841452 15:52721303-52721325 GGCCATCCTGCTGGTGCCTTTGG + Intergenic
1133756626 16:8767083-8767105 TGCCAACCTCCTTGAGACTTGGG + Intronic
1135380770 16:21994485-21994507 TGCCCTGCTCCTCGTGTCTTTGG - Intronic
1136011519 16:27366578-27366600 TGCCATTCTCTGGGTGACTTTGG - Intergenic
1139223801 16:65214249-65214271 TGTCGTACTCCTTGTGACTTTGG - Intergenic
1139696681 16:68680125-68680147 TGCCATGCCCCTGGTTCCTTGGG + Intronic
1143378372 17:6480467-6480489 TCCCATTCTCCTGGGGAATTCGG + Intronic
1145123179 17:20278904-20278926 TGTCATCCTCCTGGGGACTGAGG + Intronic
1146823785 17:36006199-36006221 TGGCATACTTCTGGGGTCTTGGG - Intergenic
1147144874 17:38479079-38479101 TGCCATAGTGATGGTGACTTGGG - Intronic
1148160530 17:45447349-45447371 TGGCAAACTCCTGGTGACTTGGG + Intronic
1150391820 17:64794230-64794252 TGGCAAACTCCTGGTGACTTGGG + Intergenic
1150788887 17:68184277-68184299 TGGCAAACTCCTGGTGACCTGGG + Intergenic
1153666822 18:7373989-7374011 GGCTATACTCCTGGTGCCTCTGG + Intergenic
1155841929 18:30657517-30657539 TGCCATACTAAAGGTCACTTAGG - Intergenic
1157566763 18:48683708-48683730 TTCATTACTCCTGGGGACTTTGG + Intronic
1161753799 19:6116746-6116768 TGCCACATTCCTGTTGACATAGG + Intronic
1164591062 19:29507232-29507254 TGCCACTTTCCTGGTGACTCTGG + Intergenic
1167618844 19:50550360-50550382 TGCCCTCCTCCTGGTCTCTTGGG - Intronic
925602961 2:5628067-5628089 TTCCCTGCTGCTGGTGACTTTGG - Intergenic
925764068 2:7214123-7214145 GGCCATACTCTTGGTGACAGAGG + Intergenic
926349471 2:11982197-11982219 AGCAATACTCCTGTTGACTGAGG + Intergenic
927861242 2:26561599-26561621 TGCCAGGCTCTTGGTGACTCGGG - Intergenic
928169191 2:28992443-28992465 TTCCATACTGCTGGTGTCCTGGG + Intronic
928350410 2:30547697-30547719 TGCCATCCTCCTGATGTCTGAGG - Intronic
929254961 2:39800547-39800569 TGCCAATCTCCTGGTGAATTTGG + Intergenic
931121575 2:59226013-59226035 TGCAAAACTGCTGATGACTTAGG - Intergenic
931295761 2:60923585-60923607 TGCCATACTTCTGGTTGCTCAGG + Exonic
932994180 2:76829025-76829047 TTCCATACCCCTGGTCACATGGG - Intronic
935728364 2:106043781-106043803 TGCCATAGTCCCAGTTACTTGGG + Intergenic
936739182 2:115484222-115484244 TGCCAAACTTATGGTGAGTTTGG + Intronic
937245343 2:120488872-120488894 TGCCATTCTCCAAGTGCCTTAGG - Intergenic
937392871 2:121506556-121506578 TGACATACTCCTGGGAACCTGGG + Intronic
938653582 2:133408548-133408570 TGGCATCATGCTGGTGACTTGGG + Intronic
941070731 2:160951740-160951762 GCCCATAGTCCTGGCGACTTGGG - Intergenic
941270850 2:163426437-163426459 TGCAATACTCTTGTTGGCTTAGG - Intergenic
942720486 2:178947125-178947147 TGACATGCTCCTGGTTATTTAGG - Intronic
946282297 2:218674724-218674746 TGCTATAATCCTGGTTACTGGGG - Intronic
948308130 2:236965108-236965130 TGCCATACTTCTGGTTCCTATGG - Intergenic
1168777431 20:459925-459947 TGCCCTAATCCAGGTGATTTTGG - Intronic
1169795484 20:9458526-9458548 GGCCATACTTCTGCTGATTTTGG + Intronic
951621260 3:24604159-24604181 TGGAATGCTCCAGGTGACTTTGG + Intergenic
952702566 3:36342124-36342146 GGCCAGACTCCTGGGGATTTGGG + Intergenic
953388302 3:42519605-42519627 TCCCATAGTCCTGTTGTCTTGGG + Intronic
959041968 3:101432149-101432171 GGCCATACTCCTTGTGGCCTGGG + Intronic
963330265 3:143906082-143906104 TGCCATACTCAAGGTTACTTGGG + Intergenic
965839260 3:172884191-172884213 TGCCCTGCTCCTGGGGACCTTGG + Intergenic
972049063 4:34705262-34705284 TTCCTTCCTCCTGTTGACTTTGG - Intergenic
975275026 4:72487074-72487096 TGCCTCACTTCTTGTGACTTTGG - Intronic
975612925 4:76219182-76219204 TGGAATACTCATGGTGACCTGGG + Intronic
977023052 4:91780064-91780086 TACCATGCTTCTGGTCACTTAGG + Intergenic
978839034 4:113187410-113187432 TGCCAAACTAATGGTCACTTTGG + Intronic
979836945 4:125382131-125382153 TTCCAAACTCCTGTTGACGTTGG + Intronic
980980877 4:139653731-139653753 AGCCATACTCCTGGTGTCCCTGG + Intergenic
981655565 4:147108599-147108621 TGCCATACTCAGGATGACTGTGG + Intergenic
981950140 4:150396288-150396310 TGCCCTACTCCTGGGAATTTAGG + Intronic
982554975 4:156849606-156849628 TGAAATACTCCAGCTGACTTTGG + Intronic
982743277 4:159080339-159080361 GCCCATAGTCCTGGTTACTTGGG - Intergenic
985017016 4:185647104-185647126 TGCATTACTCCTTGTCACTTTGG - Intronic
986593415 5:9394772-9394794 TGCCATACTACTTATAACTTTGG - Intronic
987911877 5:24157460-24157482 AGCCATACTATTGGAGACTTTGG - Intronic
988218723 5:28313780-28313802 TGCCATAAGACTGGTGATTTAGG - Intergenic
988334280 5:29885641-29885663 TCCTATAATCCTGGTTACTTGGG - Intergenic
991912561 5:71576209-71576231 GGTCATACTGCTGGGGACTTGGG - Intergenic
995517012 5:112964230-112964252 TGCCACACAACTGGGGACTTAGG + Intergenic
995689278 5:114805371-114805393 TGCCATACACCTGCTTATTTAGG + Intergenic
996998716 5:129731713-129731735 TGCAATACTAATAGTGACTTAGG + Intronic
998267604 5:140677805-140677827 TGCAATAGTCATGGTCACTTAGG + Intronic
999252562 5:150191142-150191164 TGCCACTTGCCTGGTGACTTTGG + Intronic
1001274602 5:170341203-170341225 TGCCAGACTCCTGGTGATTCTGG + Intergenic
1003181111 6:3792474-3792496 TACCAGACTGCTGGTCACTTAGG - Intergenic
1003877622 6:10452219-10452241 TGCCATACTGCAGGTGGATTTGG + Intergenic
1004752937 6:18582642-18582664 TGCCATACTGCCAGTGACTCTGG + Intergenic
1009618847 6:66045697-66045719 TTCCAGACTGCTGGAGACTTGGG + Intergenic
1009937114 6:70246852-70246874 TGCCATGCATCTGGTAACTTCGG + Intronic
1010571216 6:77476041-77476063 TCCCAGAGTCCTGGTGACCTCGG - Intergenic
1011226153 6:85109544-85109566 TGCCATGCTGCTGGTTTCTTAGG - Intergenic
1011782279 6:90802835-90802857 TTCCAGGCTCCTGGTGACTTTGG + Intergenic
1019149041 6:169992394-169992416 TCCCAGATCCCTGGTGACTTGGG - Intergenic
1021834646 7:24657494-24657516 TGCCATACTTCTGTGCACTTTGG + Intronic
1022340707 7:29464890-29464912 TCCCATACTCCTGGAGAATGTGG - Intronic
1023483076 7:40655867-40655889 TGCCATACTACTGATGTTTTAGG + Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1030108774 7:106008976-106008998 TCCCATACTCCAGGGGACTCTGG - Intronic
1031951619 7:127898485-127898507 GGCCTTTCTCCTGGTTACTTGGG - Intronic
1032438405 7:131921384-131921406 TCCCCATCTCCTGGTGACTTGGG - Intergenic
1033230259 7:139591838-139591860 TGCCATGCTCATGGAGACGTGGG - Intronic
1033576941 7:142694519-142694541 TGCCAGACTCTTAGTCACTTAGG + Intergenic
1037165190 8:15818962-15818984 ACCTATACTCCTGGTGCCTTGGG + Intergenic
1044008976 8:86968101-86968123 TGCCTTCCTCCTGGTGGATTTGG + Intronic
1049731686 8:144181439-144181461 TGCTCTGCTCCTGGTGACTTTGG + Intronic
1052336733 9:27327965-27327987 TGCCATAGTCCTGGCTACTCAGG + Exonic
1058138042 9:101328975-101328997 TGCCATTCTCCTGTTTACTGAGG - Intergenic
1058233340 9:102459044-102459066 TGCCATAGTCCTAGCTACTTGGG + Intergenic
1186019520 X:5238244-5238266 TTCCATAAACCTGGTGTCTTTGG - Intergenic
1189046420 X:37596994-37597016 TCCCACACTCCTGCTGACCTAGG + Intronic
1195254285 X:103078076-103078098 TGCAATACTCACTGTGACTTTGG - Intronic
1195281235 X:103335689-103335711 TGCTATCCTTCTGGTAACTTTGG - Intergenic