ID: 907123987

View in Genome Browser
Species Human (GRCh38)
Location 1:52033187-52033209
Sequence GAATCCGGAGTCACAAGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907123980_907123987 30 Left 907123980 1:52033134-52033156 CCAGGAGTTCGGGAGAGTAAAAG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 907123987 1:52033187-52033209 GAATCCGGAGTCACAAGAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 109
907123984_907123987 -1 Left 907123984 1:52033165-52033187 CCCATGCTTTGCAGATTTCTCTG 0: 1
1: 0
2: 2
3: 22
4: 275
Right 907123987 1:52033187-52033209 GAATCCGGAGTCACAAGAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 109
907123983_907123987 4 Left 907123983 1:52033160-52033182 CCGGACCCATGCTTTGCAGATTT 0: 1
1: 0
2: 1
3: 14
4: 216
Right 907123987 1:52033187-52033209 GAATCCGGAGTCACAAGAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 109
907123985_907123987 -2 Left 907123985 1:52033166-52033188 CCATGCTTTGCAGATTTCTCTGA 0: 1
1: 0
2: 1
3: 29
4: 325
Right 907123987 1:52033187-52033209 GAATCCGGAGTCACAAGAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907123987 Original CRISPR GAATCCGGAGTCACAAGAGC TGG Exonic
902050164 1:13557595-13557617 GAACCTGGAGTCAAAAGATCTGG + Intergenic
902991396 1:20189841-20189863 GGATCGGGTGTCACAAGACCTGG + Intronic
904419842 1:30384554-30384576 GAATCCTGTGTCACCAGAGCAGG - Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
907123987 1:52033187-52033209 GAATCCGGAGTCACAAGAGCTGG + Exonic
909993195 1:82248509-82248531 GAAAGTGGAGTAACAAGAGCTGG - Intergenic
912007966 1:104927761-104927783 GTATCAGGAGTCACCTGAGCTGG - Intergenic
912563733 1:110569942-110569964 GAATCAGGAGTAAAAAGAGCTGG + Intergenic
913535664 1:119769666-119769688 GAATCTGGAGTCAAAAGACATGG - Intergenic
914956755 1:152169517-152169539 GAATCTGGGGTCAGAAGAACTGG + Intergenic
916934497 1:169613608-169613630 GAATCCAGGGTAACAGGAGCAGG + Exonic
921764035 1:218949514-218949536 GGATCTGAAGTCACAAGACCTGG + Intergenic
1070626569 10:78055099-78055121 GAAATCGGAGTCACATGAGCTGG + Exonic
1074307722 10:112294339-112294361 GAATACTGAGGCACAAGAGAGGG + Intronic
1082131823 11:48499594-48499616 GAATCAGGAGGCACATGTGCAGG + Intergenic
1082245257 11:49913969-49913991 GAATCAGGAGGCACATGTGCAGG - Intergenic
1082565287 11:54670212-54670234 GAATCAGGAGGCACATGTGCAGG + Intergenic
1083667128 11:64281701-64281723 GAATCCGGAGTCACAGGGGCGGG - Intronic
1086911063 11:92473133-92473155 GAACCCAGAGTCACAAGTGAAGG - Intronic
1087492363 11:98844753-98844775 GAATCAGGAACCCCAAGAGCTGG + Intergenic
1088174078 11:107031432-107031454 GAACCAGGAGTACCAAGAGCAGG + Intergenic
1089829716 11:121316170-121316192 GAATCAGGAGTCTGAAGAGCAGG - Intergenic
1091079476 11:132653376-132653398 GAAGCTGGAGGCACAAGCGCAGG - Intronic
1091992550 12:4967692-4967714 CAAACCAGAGTCTCAAGAGCTGG - Intergenic
1092654896 12:10673972-10673994 GAAACCGGAGTGACCAGAGGAGG - Exonic
1093305728 12:17515070-17515092 GAATGTGGAGTCACAACAACTGG + Intergenic
1100254291 12:92866599-92866621 GAATGCTGAGTCAGAAGAGGAGG - Intronic
1104243673 12:127016319-127016341 TAATCCAGACTCAAAAGAGCTGG - Intergenic
1105324531 13:19358125-19358147 GAAACTGAAGTCACAGGAGCAGG + Intergenic
1105424774 13:20284891-20284913 GAATCAGGAGGCCCAAGAGAGGG + Intergenic
1105868778 13:24485591-24485613 GAAACTGAAGTCACAGGAGCAGG - Intronic
1106620612 13:31367482-31367504 GAATCAGGAGGCCCAAGAGAGGG + Intergenic
1108098728 13:46932609-46932631 GAATGTGGGGTCAAAAGAGCAGG + Intergenic
1111632878 13:90865646-90865668 GAATGTGGAATCACAAAAGCAGG + Intergenic
1114341192 14:21746316-21746338 GAATCCTGAATCACCAGAACTGG - Intergenic
1115837692 14:37427416-37427438 GAATACGGAGTTATAAGAGTGGG + Intronic
1115962794 14:38854449-38854471 GAATCCAGATTCAAAACAGCTGG - Intergenic
1116905586 14:50400377-50400399 GAATTTGGAGTCAGAAGACCAGG + Intronic
1118246283 14:64114291-64114313 TAATCGAGTGTCACAAGAGCAGG + Intronic
1119465563 14:74855417-74855439 GAATCAGGGGCCACTAGAGCAGG - Intronic
1120064215 14:80020655-80020677 GACTCCGGAGTCACAAGACTTGG - Intergenic
1122320642 14:100853299-100853321 GAGTTGGGAGTCACAAGAGGAGG - Intergenic
1124038827 15:26081800-26081822 GAAGCAGGAGTCACTAGGGCTGG - Intergenic
1128730868 15:70020083-70020105 GAGTCAGGAGTCAGAAGACCTGG + Intergenic
1136713500 16:32258952-32258974 GAATCAGGACTCACTGGAGCTGG - Intergenic
1136754411 16:32670479-32670501 GAATCAGGACTCACTGGAGCTGG + Intergenic
1136813702 16:33199886-33199908 GAATCAGGACTCACTGGAGCTGG - Intronic
1136820178 16:33309966-33309988 GAATCAGGACTCACTGGAGCTGG - Intergenic
1136826741 16:33366505-33366527 GAATCAGGACTCACTGGAGCTGG - Intergenic
1136831807 16:33465276-33465298 GAATCAGGACTCACTGGAGCTGG - Intergenic
1138044415 16:53706054-53706076 GAATTTGGAGTCAGAAGACCTGG - Intronic
1138129603 16:54468625-54468647 GAATGTGGAGTCAGAAGACCCGG + Intergenic
1139062404 16:63268973-63268995 GAATCCGGTGTCAGATGACCTGG + Intergenic
1202992278 16_KI270728v1_random:22860-22882 GAATCAGGACTCACTGGAGCTGG - Intergenic
1203056558 16_KI270728v1_random:930810-930832 GAATCAGGACTCACTGGAGCTGG + Intergenic
1143222856 17:5276891-5276913 GAATCCAGATTCTCAAGAGCAGG - Intergenic
1145263743 17:21369569-21369591 GAGGCCAGAGTCACAGGAGCAGG - Intergenic
1150416660 17:64994080-64994102 GACTCCGGAGCTACAACAGCCGG + Intergenic
1156039744 18:32807170-32807192 GACTCTGGAGTCAGAAGAGCTGG + Intergenic
1159912682 18:74161447-74161469 AAATCCGGAGTCACACGGGGAGG + Intergenic
1159912691 18:74161501-74161523 AAATCCGGAGTCACACGGGGAGG + Intergenic
1161514161 19:4687471-4687493 GAACCCGGAGTCACCAATGCAGG + Intronic
1166108539 19:40609608-40609630 GAAGCCAGAGTCGCAAGCGCAGG - Exonic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167954575 19:53054479-53054501 GAATTTGGAGTCAGAAGACCAGG + Intergenic
925840327 2:7985854-7985876 GAATGAGGAGTCTCAAGAGAAGG - Intergenic
928337694 2:30412239-30412261 AAATCAGGAGTCAAAAGTGCTGG - Intergenic
929375107 2:41276233-41276255 GAATACGGAGGCCCAAGAGAAGG + Intergenic
931184932 2:59940611-59940633 GCAACAGCAGTCACAAGAGCTGG + Intergenic
933627964 2:84623360-84623382 GAATTTGGAGTCAAAAGAGTCGG - Intronic
935358522 2:102227239-102227261 GAGGCCTGAGTGACAAGAGCAGG + Intronic
938546046 2:132332672-132332694 GAGTCTGGAGTCACACGAGAGGG - Intergenic
946054525 2:216889210-216889232 GAGTCTGGAGTCTCAAGAGATGG + Intergenic
1169773425 20:9226067-9226089 GAATCAAGTGTCACAAAAGCAGG + Intronic
1170528669 20:17267172-17267194 GAATCTGTAGGCACATGAGCTGG + Intronic
1171874910 20:30565405-30565427 GAGTCCGGAGTCACACGAGAGGG - Intergenic
1172079879 20:32331714-32331736 GAATCAGGAGTCACCTTAGCAGG + Exonic
1173142598 20:40497324-40497346 GCATCCTAAGTCACAAGAGGTGG - Intergenic
1174254232 20:49242406-49242428 GGCTCCGGAGTCAGAAAAGCTGG - Intronic
1175603238 20:60291850-60291872 GCATCTGGAGTCAGAAGACCTGG + Intergenic
1176141297 20:63546261-63546283 GAAGCCGGAGTCACAGGAAGGGG - Intronic
1177465336 21:21471155-21471177 GTATCCGAAGGCACAAGAGCTGG - Intronic
1181845300 22:25702910-25702932 GACTCCAGAGTCAGAAAAGCTGG - Intronic
1185173840 22:49307996-49308018 GAAGCAGGAGTCACAGGAGTGGG + Intergenic
954577822 3:51686516-51686538 GAATCAGGAGTGAGAAGACCTGG + Intronic
959013027 3:101100423-101100445 GTATCAGAAGTCACAGGAGCAGG - Intergenic
961033991 3:123629623-123629645 GACTCTGGAGAGACAAGAGCAGG + Exonic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
964412415 3:156412709-156412731 GAATCTAGAGGCAGAAGAGCAGG + Intronic
965382369 3:168005833-168005855 GACTCAGGAGTCAGAAGAGTGGG + Intergenic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
970057161 4:11988171-11988193 GAATCCAGAGCCAAATGAGCAGG - Intergenic
971129429 4:23789971-23789993 GAATGCGGGGTCACATGGGCTGG - Intronic
972105695 4:35482975-35482997 GACTCTGGAGTCACCAGACCAGG + Intergenic
975818561 4:78245766-78245788 GAATTAGGAGTCAGAAGACCAGG - Intronic
979313905 4:119236848-119236870 CAATCAGGATTCACAAGAGGAGG - Intronic
980039831 4:127926433-127926455 GAATAAGGAGTGACAAGGGCAGG - Intronic
983257613 4:165418219-165418241 AAATCAGGAGACACAAGAGTGGG + Intronic
999976028 5:156913096-156913118 GAATCATGAGTCACAAGGCCGGG - Intergenic
1000706866 5:164523405-164523427 GAATCCTGAGTCAGAAGTTCAGG + Intergenic
1007066212 6:38992606-38992628 GACTGGGGAGTCACGAGAGCTGG + Intronic
1010636257 6:78261983-78262005 GACTCTGGAGTCACATGACCTGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1012955675 6:105567342-105567364 GACTACGGAGTCAAAAGAGATGG + Intergenic
1022599890 7:31747811-31747833 GAGTCAGGAGTCACAAGTCCAGG + Intergenic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1026994428 7:74606408-74606430 AAATCCAGAGTCACAGGATCGGG - Intergenic
1031965497 7:128025303-128025325 GACTCAGGAGTCAAAAGACCTGG + Intronic
1033341734 7:140497436-140497458 GAGTCATGAGTCACAAGTGCAGG + Intergenic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1034025780 7:147702213-147702235 GACTCTGAAATCACAAGAGCTGG + Intronic
1035851046 8:2919606-2919628 GAATTAGGAGCTACAAGAGCTGG - Intergenic
1037665299 8:20963878-20963900 GAAACCAGAGTGAGAAGAGCTGG + Intergenic
1038057945 8:23879501-23879523 GAAACAGGAGTCACAACTGCAGG - Intergenic
1046123327 8:109872400-109872422 GAAACCTGAGTCACAAAAACAGG + Intergenic
1189423202 X:40875123-40875145 AAATCTGGAGTCACAAGCCCTGG - Intergenic
1189449208 X:41111596-41111618 GAATCCTGAGTCAGGAGAGTTGG + Intronic
1194373484 X:93103775-93103797 GAATCAGGAGGCACATGTGCAGG + Intergenic
1194865101 X:99055326-99055348 GAATCTGGAAGCCCAAGAGCAGG - Intergenic
1196049593 X:111290911-111290933 GAAGCAGAATTCACAAGAGCAGG + Intergenic