ID: 907125825

View in Genome Browser
Species Human (GRCh38)
Location 1:52050010-52050032
Sequence GAACTGAAACAGCTTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 7, 3: 81, 4: 513}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907125824_907125825 -3 Left 907125824 1:52049990-52050012 CCTTTATAAATAAGGAAGCTGAA 0: 1
1: 2
2: 4
3: 57
4: 513
Right 907125825 1:52050010-52050032 GAACTGAAACAGCTTGCCCAAGG 0: 1
1: 0
2: 7
3: 81
4: 513
907125823_907125825 -2 Left 907125823 1:52049989-52050011 CCCTTTATAAATAAGGAAGCTGA 0: 1
1: 2
2: 49
3: 342
4: 1358
Right 907125825 1:52050010-52050032 GAACTGAAACAGCTTGCCCAAGG 0: 1
1: 0
2: 7
3: 81
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907125825 Original CRISPR GAACTGAAACAGCTTGCCCA AGG Intronic
900097204 1:944740-944762 GAGCTGCAGCAGCTGGCCCAGGG - Exonic
901254227 1:7807450-7807472 AAACTGAAACAGTTTCCCAAAGG - Intronic
901843192 1:11966375-11966397 GAAGGGAAACTGCTTGCCCTGGG + Intronic
902134698 1:14294878-14294900 GATCTGAATGAGCTTGGCCAAGG - Intergenic
902140577 1:14350291-14350313 GAATTTAAACAGCTTTCCCAAGG - Intergenic
902569583 1:17338617-17338639 GAACTTAAGCAATTTGCCCAAGG + Intronic
902743139 1:18454397-18454419 GAATTGAAGCAACTTGCACAAGG - Intergenic
903065241 1:20696076-20696098 GAGCTCAAACAACCTGCCCAAGG + Intronic
903358621 1:22763198-22763220 GAAGTGAAGCAACCTGCCCAAGG - Intronic
903408491 1:23119472-23119494 GAAATGAAGCAGTTTGCCTAAGG - Intronic
903570552 1:24301320-24301342 GAGCAGAAAGAACTTGCCCAAGG - Intergenic
903671247 1:25036957-25036979 GAAGTGAAATAGCTTATCCAAGG + Intergenic
903772817 1:25774679-25774701 AAAGTGAAATAACTTGCCCAAGG + Intronic
903866108 1:26399234-26399256 GCACTGGAACAGCTTGCCTGAGG - Intergenic
904166670 1:28560890-28560912 GAATTGAAATAACTTGTCCAAGG + Intronic
904429099 1:30450498-30450520 GAGCTTAAACAACTTGCCCCAGG - Intergenic
904467109 1:30714685-30714707 GAAGTGAAAAAACTTGCCCATGG + Intronic
904472190 1:30742765-30742787 GAAGTCAAGTAGCTTGCCCAGGG - Intronic
904497504 1:30895472-30895494 GAAGTGGAACAGCTTCCCCGGGG - Intronic
904766313 1:32851081-32851103 GAAGTGAAATAATTTGCCCAGGG + Intronic
905488630 1:38326160-38326182 GAAGTAAAATGGCTTGCCCAAGG - Intergenic
905512547 1:38533612-38533634 GAGATGAAATAACTTGCCCACGG - Intergenic
906119305 1:43377765-43377787 GAAGTGAACTAACTTGCCCAAGG + Intergenic
906463607 1:46056936-46056958 GAAGTTAAATAACTTGCCCATGG - Intronic
907125825 1:52050010-52050032 GAACTGAAACAGCTTGCCCAAGG + Intronic
907787186 1:57624046-57624068 GAGGTGAAACAGCTTGCCTGGGG - Intronic
908804567 1:67916786-67916808 GAGGTTAAACAACTTGCCCAAGG - Intergenic
908845567 1:68321151-68321173 GAGCTTAAGCAACTTGCCCAAGG + Intergenic
909196698 1:72635724-72635746 GAACTGAAATAACTTGTCCAGGG + Intergenic
909699952 1:78511473-78511495 GAGCTGAAACAGCCTGAACATGG + Intronic
909888521 1:80973284-80973306 GAATTTAAACAACTAGCCCAAGG + Intergenic
910597546 1:88995197-88995219 GAAATGAAATAACTTGCCCAAGG - Intergenic
910769615 1:90817706-90817728 GAGGTTAAGCAGCTTGCCCAGGG - Intergenic
910976335 1:92910044-92910066 GAACACAAAGAGCTTGCCCTAGG - Intronic
911029997 1:93476966-93476988 GAAGTTAAATGGCTTGCCCAAGG + Intronic
911716376 1:101138240-101138262 AAAGTTAAACAACTTGCCCATGG - Intergenic
912466007 1:109874448-109874470 GAACTGAAGAAGGCTGCCCAAGG + Intergenic
913681449 1:121189586-121189608 GAACTGAAGAGGCTTGTCCAAGG + Intronic
914033280 1:143977223-143977245 GAACTGAAGAGGCTTGTCCAAGG + Intergenic
914156166 1:145090744-145090766 GAACTGAAGAGGCTTGTCCAAGG - Intronic
914254265 1:145948336-145948358 GAAGTTAAATAACTTGCCCAAGG + Intronic
914959369 1:152192669-152192691 GAAGTTAAGCAGCTTTCCCAAGG - Intergenic
915296281 1:154924022-154924044 GAAGTGAAACAACTTCTCCAGGG - Intergenic
915431471 1:155870260-155870282 AAAGTGAAGCAGCTTGCCCAAGG - Intronic
915478825 1:156171181-156171203 GAGGTGAAACAGCTTGTCTAAGG + Intronic
915553520 1:156648475-156648497 GAACTGGAGAAGCTTGCCCAGGG + Intronic
915741249 1:158120074-158120096 GACCTGAGACACCCTGCCCAGGG - Intergenic
916769089 1:167890869-167890891 GAAGTAACACAGCTTTCCCAAGG + Intronic
917155735 1:171996619-171996641 GAAGTTAAATAACTTGCCCAAGG - Intronic
917188669 1:172390328-172390350 GAGGTTAAACAGCTTGCCCAAGG + Intronic
917224416 1:172766345-172766367 GAACTGAAACAGTTTGCTTTAGG + Intergenic
918016798 1:180642567-180642589 GAGATGAAATAGATTGCCCAAGG + Intronic
918037360 1:180887625-180887647 GAAGTTAAGCAGCTTGCCTAAGG - Exonic
918785708 1:188760229-188760251 TAACTTGAACAGCTAGCCCACGG + Intergenic
918893665 1:190311133-190311155 GAACTGAAACAGCAAGCACAAGG + Intronic
919352519 1:196476567-196476589 GAAATGAAAGAGCTTTCACATGG - Intronic
920066202 1:203271804-203271826 GAAGTTAAGCAGCTTGCCCAAGG + Intronic
920468763 1:206208104-206208126 GAACTGAAGAGGCTTGTCCAAGG + Intronic
920693746 1:208165877-208165899 GCACTGAATCAGCTTGCCAATGG - Intronic
920965263 1:210696047-210696069 GAACTGAAGAAGCTTGTGCAGGG - Intronic
921274494 1:213505450-213505472 GAGATTAAGCAGCTTGCCCAAGG - Intergenic
921425427 1:214995889-214995911 AAAGAGAAACATCTTGCCCAAGG - Intergenic
921950234 1:220921975-220921997 GAACTGAATCAGCTGGCACCCGG + Intergenic
922769389 1:228173827-228173849 GAACTGCAATAGCCTGCCCGAGG - Intronic
923185024 1:231563486-231563508 GAGATGAAATAACTTGCCCAAGG + Intronic
923348682 1:233082123-233082145 GAAGTTAAAGAACTTGCCCAAGG - Intronic
924267636 1:242299451-242299473 GAACTTAAGTAACTTGCCCAGGG + Intronic
924319511 1:242834526-242834548 GAAGAGAACCACCTTGCCCATGG - Intergenic
1063338830 10:5243935-5243957 GAACTGAGACAGCAGGCTCAGGG - Intergenic
1064278999 10:13933790-13933812 GAAAGGAAGCAGCTTCCCCAAGG + Intronic
1064471460 10:15640094-15640116 GAACTGCAACCGCTTGCAAAAGG + Intronic
1064707931 10:18092069-18092091 AAAGTGAACTAGCTTGCCCAAGG - Intergenic
1065813836 10:29466972-29466994 GAAGTTAATCAACTTGCCCAAGG - Intronic
1066717250 10:38299287-38299309 GAACTTAAGTAACTTGCCCAGGG - Intergenic
1069091061 10:64199159-64199181 GAAATTAAATAACTTGCCCAAGG + Intergenic
1069265281 10:66449571-66449593 GAATTGAAAAAGCTTTCCAAAGG - Intronic
1069624343 10:69858400-69858422 GAGGTTAAGCAGCTTGCCCAAGG + Intronic
1069687481 10:70327723-70327745 GAGGTGAAATAACTTGCCCAAGG + Intronic
1070425195 10:76280335-76280357 AAGCTGAACCAGCTTGCTCAAGG - Intronic
1071295376 10:84215534-84215556 GACTTTAAACAGCTTTCCCAAGG - Exonic
1072032892 10:91538278-91538300 GAAGGGAAGCAACTTGCCCAAGG + Intergenic
1072213406 10:93267790-93267812 GAACTGAAACAATTTGCCCAAGG + Intergenic
1072239411 10:93481441-93481463 GAAATGAAGTAACTTGCCCAAGG + Intronic
1072538130 10:96378647-96378669 GAGGTTAAATAGCTTGCCCAAGG + Intronic
1072664278 10:97382572-97382594 GAAGTCAAATAACTTGCCCAAGG + Intronic
1072835897 10:98711552-98711574 GAAGTTAAACAACTTACCCAAGG - Intronic
1073005754 10:100322903-100322925 AAAGTCAAACAGCTTGCTCAAGG - Intronic
1073246813 10:102096636-102096658 GAGGTCAAGCAGCTTGCCCAAGG - Intergenic
1073527165 10:104194835-104194857 GAAGTCCAGCAGCTTGCCCAAGG + Intronic
1073564262 10:104521792-104521814 GAGGTGAAGCAACTTGCCCAGGG + Intergenic
1074135913 10:110626266-110626288 GAACTTAAGTACCTTGCCCAAGG + Intergenic
1074580994 10:114719369-114719391 GAACTGAAGGACCTTGTCCAGGG + Intergenic
1074876204 10:117615334-117615356 GAAGTTAAACAACTTGCCCAGGG - Intergenic
1075327529 10:121546343-121546365 GAGCTGAAAAAACTTGCCCATGG + Intronic
1075455893 10:122584743-122584765 GCACTGACATTGCTTGCCCATGG - Intronic
1075461534 10:122619729-122619751 GCACTGACATTGCTTGCCCATGG - Intronic
1075703845 10:124486736-124486758 AAACTGATACAGCTGGGCCAGGG + Intronic
1075925814 10:126251379-126251401 GAAGTTAAAGAACTTGCCCAAGG + Intronic
1077151795 11:1076108-1076130 TAACTGAAACCCCTTGCCTATGG - Intergenic
1077988230 11:7376877-7376899 GAGGTTGAACAGCTTGCCCATGG - Intronic
1078362605 11:10680702-10680724 AAGATGAAACAGCTTGCCCAAGG - Intronic
1078577849 11:12516848-12516870 GAAGTGACATAACTTGCCCAAGG + Intronic
1078682328 11:13488436-13488458 GTACTGAATCAGCTTGCCTCAGG + Intergenic
1078952923 11:16155518-16155540 GAGGTTAAACAACTTGCCCAAGG - Intronic
1078965032 11:16329515-16329537 AAACTGGAAAATCTTGCCCAGGG - Intronic
1078989324 11:16630358-16630380 GAAATGAAACAACTTACCCCTGG - Intronic
1079024663 11:16936961-16936983 GGAGGGAAACAGCTTGCCCAAGG - Intronic
1079363270 11:19787551-19787573 CAAATTAAACAACTTGCCCAGGG - Intronic
1080667646 11:34349869-34349891 GAAGTGAAACAACTTGCCCAGGG + Intronic
1080708856 11:34726439-34726461 GAATATAAACAGCTTGCCCAAGG - Intergenic
1080750569 11:35146625-35146647 GAATTTAAGTAGCTTGCCCAAGG + Intronic
1081388186 11:42497905-42497927 GAAGTGAAATAACTTGACCAAGG - Intergenic
1081658334 11:44872747-44872769 GAGGTGAAGCAACTTGCCCAAGG + Intronic
1083259325 11:61514663-61514685 GGAAGGAAAGAGCTTGCCCAGGG + Intergenic
1084148661 11:67278049-67278071 GAGGTGAAGCAACTTGCCCAAGG - Intronic
1085625136 11:78066030-78066052 GAAATGAATTAGCTTGCCCAAGG - Intronic
1085781757 11:79415568-79415590 GAGCTTAAGTAGCTTGCCCAAGG + Intronic
1085925985 11:81021654-81021676 GAATTTAAGCAACTTGCCCAAGG + Intergenic
1086907832 11:92437410-92437432 GAAGTTAAATAGCTTGCCCAAGG - Intronic
1088541929 11:110921790-110921812 GAATTGAGAGAGCTGGCCCAGGG - Intergenic
1088969397 11:114759326-114759348 GACATGAAACAGCTTCCCCACGG - Intergenic
1089005437 11:115086987-115087009 GAAGTTAAGCAGCTTGTCCAAGG - Intergenic
1089206866 11:116771572-116771594 GAGATGAAACACCTTGCCCAAGG + Intronic
1089365273 11:117917622-117917644 GAAGTGAAATCACTTGCCCAGGG + Intronic
1090242923 11:125196657-125196679 GAGGTGAGGCAGCTTGCCCAAGG - Intronic
1090327156 11:125898875-125898897 GAAGTTAAATAACTTGCCCAAGG - Intronic
1090479129 11:127052559-127052581 GGTCTGAAACAGCCAGCCCATGG + Intergenic
1090848390 11:130549043-130549065 GAAGTGAAACAACTTGTTCAAGG + Intergenic
1091232299 11:133996582-133996604 AAAATGAAGCAACTTGCCCAGGG + Intergenic
1091391306 12:127979-128001 GAAGTCAAGCAACTTGCCCAAGG - Intronic
1091912847 12:4245587-4245609 GAAAATAAGCAGCTTGCCCAAGG - Intergenic
1092168230 12:6356135-6356157 GAGCTCAAACAGCTGGCCCAAGG + Intronic
1092495530 12:8990056-8990078 GAATTTAAACAGCTGGTCCAAGG - Intronic
1092995359 12:13944664-13944686 AAAGTGCAACAACTTGCCCAAGG + Intronic
1094699696 12:32856965-32856987 GAAGTAAAATATCTTGCCCAAGG + Intronic
1095387086 12:41663255-41663277 GAAGTGAAATAACTTGCACAAGG + Intergenic
1095580550 12:43792241-43792263 GAACTGAAGCAGACTGACCAAGG + Intergenic
1095972587 12:47913049-47913071 GAAATGAAACATCTTTCTCAAGG - Intronic
1098302109 12:69064805-69064827 AAGCTGAAACAACTTGCCCAAGG - Intergenic
1098525652 12:71483669-71483691 GAACTTAAGTAGCTTTCCCAAGG - Intronic
1098812138 12:75108263-75108285 GAAGTTAAGTAGCTTGCCCAAGG - Intronic
1098985259 12:77005260-77005282 GAAATGAAAGAGCATGCCCTTGG + Intergenic
1099660341 12:85550158-85550180 GCACTGAAACAGGTTTCCAAGGG + Intergenic
1099952719 12:89322517-89322539 GAAATGAAATAGCTTGGGCAGGG - Intergenic
1100178069 12:92053232-92053254 CAACTGGAACAGTTTCCCCAGGG - Intronic
1100197327 12:92261914-92261936 GGAATTAAATAGCTTGCCCATGG + Intergenic
1100313933 12:93425991-93426013 GAAATGAAACAGCTTGGTTAGGG + Intronic
1100469541 12:94877903-94877925 GAGATGAAACACCTTGCCAAAGG + Intergenic
1100891207 12:99128027-99128049 GAAGTTAAACAACTTGCCCAAGG - Intronic
1101035378 12:100700962-100700984 GAAATGAAATAACTTGCCCAAGG + Intergenic
1101315625 12:103626416-103626438 GAATTTAAATAGCTTGCCCTCGG - Intronic
1101346353 12:103889792-103889814 GAAGTGAAATAACTTACCCAAGG + Intergenic
1101445918 12:104736727-104736749 GAACTGAACCAGCTTCTCAAAGG - Intronic
1101535310 12:105611124-105611146 GAACTGAAGGCACTTGCCCAAGG - Intergenic
1101822749 12:108196394-108196416 GAGATGAAGCGGCTTGCCCAAGG + Intronic
1102001975 12:109563114-109563136 GCAGGGAAGCAGCTTGCCCAAGG - Intronic
1102172336 12:110851879-110851901 GAACTGAAGTGGCTTGCCCGAGG + Intronic
1102573101 12:113839535-113839557 GAGATGAAGCACCTTGCCCAAGG - Intronic
1102765246 12:115427219-115427241 GAAGTGAAGTAGCTTACCCAAGG + Intergenic
1103558629 12:121780597-121780619 GAGGTTAAGCAGCTTGCCCAGGG - Exonic
1103723552 12:122987086-122987108 GAAGTGACATCGCTTGCCCAAGG + Intronic
1105590364 13:21787730-21787752 AAAATGAAACAACTTGTCCAAGG - Intergenic
1105898633 13:24739210-24739232 GAGTTGAAGCAACTTGCCCAAGG + Intergenic
1106638438 13:31557136-31557158 GAACTGAAATACCTTGGTCAGGG + Intergenic
1107352489 13:39530337-39530359 GAACTGAAACAGAGTGCGGAGGG + Intronic
1107830078 13:44367258-44367280 GAAGTTACAGAGCTTGCCCAAGG - Intergenic
1108221635 13:48240072-48240094 GAACTGAAGTAACTTACCCAAGG - Intronic
1108840660 13:54610396-54610418 GAAATGAATCAGCTTACTCAGGG - Intergenic
1110260580 13:73480385-73480407 AAAATTAAACAACTTGCCCAAGG + Intergenic
1110621416 13:77599926-77599948 GAAATTACACAACTTGCCCAGGG - Intronic
1110842774 13:80161770-80161792 GAAATGCAACAGCTTGACCATGG + Intergenic
1111683471 13:91472740-91472762 GAACTGAAACAGTTTTCTGAAGG + Intronic
1111907421 13:94271539-94271561 GAAGGGAAATAACTTGCCCAAGG - Intronic
1112016278 13:95334036-95334058 GAAGTTAGACAACTTGCCCAAGG + Intergenic
1113625997 13:111846937-111846959 GACAGGAAGCAGCTTGCCCAGGG + Intergenic
1113884196 13:113649358-113649380 GAAGTGAAACGGTTTGCGCAGGG - Exonic
1114039476 14:18663165-18663187 GAACTGAAAAACCTTTCTCAGGG - Intergenic
1114119708 14:19657808-19657830 GAACTGAAAAACCTTTCTCAGGG + Intergenic
1114368332 14:22054960-22054982 GAAATTAAACAACTTGCTCATGG + Intergenic
1114740984 14:25096774-25096796 GAAATTAAACAACTTGCTCAAGG - Intergenic
1114938326 14:27573244-27573266 GCACTGCATCAGCTTGCCAATGG + Intergenic
1115080082 14:29440062-29440084 AAGTTTAAACAGCTTGCCCAGGG + Intergenic
1115175888 14:30560982-30561004 GAGGTTAAACAGCTTGCCCAGGG - Intronic
1116672176 14:47857344-47857366 GAACTGAAATAAGTTGCCCAGGG + Intergenic
1117991473 14:61438125-61438147 GATGTTAAACAACTTGCCCAGGG + Intronic
1118455250 14:65940149-65940171 GAACTGAACCAGCTTGGATAGGG - Intergenic
1119463259 14:74829975-74829997 GGACTGAATGATCTTGCCCAAGG + Intronic
1119662250 14:76460330-76460352 GAGCTGAAGCAGGTTACCCAAGG - Intronic
1120896948 14:89541821-89541843 GAAGTGAAAAAGTTTGCTCAAGG - Intronic
1121867902 14:97379682-97379704 GAGGTGAAACAACTTGCCCCGGG - Intergenic
1121914340 14:97822401-97822423 GAACTCAGACACCTTGCCCAAGG + Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1125308044 15:38344631-38344653 GAACCTAAGTAGCTTGCCCAAGG - Intronic
1125342153 15:38685768-38685790 GAAGTTCTACAGCTTGCCCAAGG + Intergenic
1126921367 15:53529323-53529345 GAAGTGAAACGGCATGCCCAAGG - Intronic
1127573127 15:60263462-60263484 GAAGTGAAGGAACTTGCCCAGGG - Intergenic
1127647182 15:60970529-60970551 AATCTGAAACAGCTTCACCAAGG - Intronic
1127751971 15:62054965-62054987 GAACTGAAATGTTTTGCCCAGGG + Intronic
1128225225 15:65996870-65996892 GAAGTAAAGCAGCTTGCCCAAGG + Intronic
1128336059 15:66786441-66786463 GAACTCAAGTAACTTGCCCAAGG - Intergenic
1128354145 15:66912770-66912792 GCACTGAAATAACTTGCCTAAGG - Intergenic
1128435122 15:67639458-67639480 GAAGTTAAATAACTTGCCCAAGG + Intronic
1128816160 15:70610108-70610130 GGATTAAAGCAGCTTGCCCAAGG - Intergenic
1128889301 15:71316660-71316682 GAACTGAGGAAGCTTGCCCCAGG - Intronic
1129042697 15:72703616-72703638 GAAGTGAAATAACTTGCCCTAGG + Intronic
1129064007 15:72885845-72885867 GGACTGAAACGACTTGCTCAAGG - Intergenic
1129171504 15:73810873-73810895 GAAGTTAAATAACTTGCCCAAGG + Intergenic
1129895649 15:79103919-79103941 GAAGTGGAGCAACTTGCCCAAGG - Intergenic
1130116874 15:81013121-81013143 GAATTGAAACCACTTGCCTAGGG + Intronic
1131020110 15:89090228-89090250 GAAGTTAAGTAGCTTGCCCAAGG - Intronic
1131077387 15:89503864-89503886 GAAGTTAAGCAGCTTGCCCAAGG - Intergenic
1131570889 15:93535049-93535071 GAACTGTAACGGGTTGCCCCTGG - Intergenic
1131916768 15:97274447-97274469 CAACTGAAATATCTTCCCCAAGG - Intergenic
1132343191 15:101090917-101090939 TAACTGGAACAGATGGCCCAGGG + Intergenic
1133368044 16:5226504-5226526 AAACTGGAGCAGCTTGCCCAAGG + Intergenic
1133889496 16:9865780-9865802 GTGCAGAAACAGCTTGCCCTTGG - Intronic
1134067214 16:11236542-11236564 GAGGTGAAACAACTTGCTCAAGG - Intergenic
1134376389 16:13678857-13678879 GAACTGAAACCATTTGCCAATGG - Intergenic
1134598762 16:15516748-15516770 GAAATGAAACAGCCTGCCCAAGG + Intronic
1134637312 16:15802358-15802380 GAAGTGAGGCAACTTGCCCAAGG + Intronic
1134660160 16:15977947-15977969 GAAGTAAAGCAACTTGCCCAAGG - Intronic
1134749019 16:16611083-16611105 GAAGTGAGATAACTTGCCCAAGG - Intergenic
1134862965 16:17577370-17577392 GTACTCAGACAGCTTGCCTAAGG + Intergenic
1134996446 16:18742553-18742575 GAAGTGAGATAACTTGCCCAAGG + Intergenic
1135032053 16:19046252-19046274 GAGCTTAAATAACTTGCCCAAGG - Intronic
1135406869 16:22204930-22204952 GAAGTAAAATAACTTGCCCAAGG + Intergenic
1135838503 16:25851242-25851264 AAAATGAAACAGCTTGGGCATGG - Intronic
1136534134 16:30889234-30889256 GAAATGAAGTAGCTGGCCCAAGG - Intronic
1137383983 16:48024634-48024656 GAAGTGAAGCAGCCAGCCCAAGG + Intergenic
1138858701 16:60728258-60728280 GAGGTTAAACAGCTTACCCAAGG - Intergenic
1140959539 16:79898879-79898901 GAGCTGAAGGAACTTGCCCAAGG - Intergenic
1141034926 16:80618576-80618598 GAACAGAAACAGGGTACCCAGGG - Intronic
1141140734 16:81495302-81495324 TCACTGAACCAGCCTGCCCAGGG - Intronic
1143861783 17:9896689-9896711 GACAGGAAGCAGCTTGCCCAAGG - Exonic
1143902010 17:10181470-10181492 GAACAGGAACAGCATGCACAGGG + Intronic
1144218267 17:13076687-13076709 GAGGTGAAACGACTTGCCCAAGG - Intergenic
1145770919 17:27492507-27492529 GAAGGGAAGCAGCTTGTCCAAGG - Intronic
1145840861 17:27993244-27993266 GAACTTAAACAACTTGTTCAAGG + Intergenic
1146909269 17:36637926-36637948 AAACTGAAGCACTTTGCCCATGG - Intergenic
1148071822 17:44913120-44913142 GAAGTGAGATGGCTTGCCCAGGG - Intronic
1148676243 17:49446925-49446947 GAAGTGAAGCAACGTGCCCAAGG - Intronic
1148759479 17:49992089-49992111 GAGGTTAAACAACTTGCCCAAGG - Intronic
1149438224 17:56652280-56652302 GAGGTGAAATAACTTGCCCAGGG + Intergenic
1149455961 17:56788858-56788880 GAGGTTAATCAGCTTGCCCAAGG + Intergenic
1149868199 17:60162085-60162107 GAACGGGCACAGCTTGTCCAGGG + Intronic
1150638647 17:66934240-66934262 GAGGTGAAAGACCTTGCCCAGGG + Intergenic
1150646682 17:66983004-66983026 GAAGTTAAGCAGCTTGCCCAAGG + Intronic
1151166056 17:72204925-72204947 GAGATGAAACAACTTGGCCAGGG + Intergenic
1151221685 17:72617548-72617570 GAAATTAAACATCTTGCCCAAGG - Intergenic
1151602558 17:75115215-75115237 GAGCTGAGTCAGATTGCCCATGG + Intronic
1154435829 18:14340947-14340969 TTACTGAAACAGCTTCTCCATGG - Intergenic
1156388873 18:36631669-36631691 GAGTTGAAGCACCTTGCCCAAGG + Intronic
1157183433 18:45517881-45517903 GAAAACAAACAGCTTGCTCAAGG + Intronic
1157305740 18:46516183-46516205 GAGGTGAAATAACTTGCCCAAGG - Intronic
1157676136 18:49569927-49569949 GAGGTGAGACAACTTGCCCAGGG + Intronic
1157832272 18:50867456-50867478 GCACTGCAACAGCATGCCCAGGG - Intergenic
1158817312 18:61118030-61118052 GAAGTGAAATAACATGCCCATGG + Intergenic
1158895900 18:61912524-61912546 GATCTGAAAGAGCTTGCACTGGG - Intergenic
1159034808 18:63266744-63266766 GTGGTGAAGCAGCTTGCCCAAGG - Intronic
1159059073 18:63495502-63495524 AATCTGAAACAGGTTGCCAATGG + Intronic
1160955662 19:1690612-1690634 GAAGCCAAGCAGCTTGCCCAAGG - Intergenic
1161266006 19:3365121-3365143 GAACGGAAGCCACTTGCCCAGGG - Intronic
1164029794 19:21393773-21393795 AAACAAAAACAACTTGCCCAAGG - Intergenic
1165403463 19:35616339-35616361 GAAGTTAAATACCTTGCCCAAGG - Intronic
1165998173 19:39860161-39860183 GAAGTTAAATAACTTGCCCAAGG - Intergenic
1166110528 19:40620076-40620098 GAACTGAAACAGGTTCAACATGG + Intronic
1166887484 19:45971070-45971092 AAAATGAAACCGCTTGCCCAAGG - Intronic
1167035371 19:46992256-46992278 GAGGTGATACAGCCTGCCCAGGG + Intronic
1167526966 19:49990219-49990241 GAACTGGTATAGCTTGCCCAAGG - Intronic
925390114 2:3488837-3488859 CAACTGAAACCACTTTCCCATGG - Intergenic
925911117 2:8574244-8574266 GAGCTGAAAGAATTTGCCCAAGG + Intergenic
925920713 2:8636069-8636091 GAGCAGAAACGGCTTGCCCATGG - Intergenic
925975006 2:9136285-9136307 GAACTGCCACTGCTTCCCCATGG + Intergenic
926048136 2:9725113-9725135 GAAGTTAAACAGCTTGGCCAAGG - Intergenic
928952652 2:36826927-36826949 GAAGTGAAACAACTTGTCCCAGG + Intergenic
929827468 2:45320265-45320287 GAAATTAAACAGCTTGCACCAGG - Intergenic
931067507 2:58603319-58603341 GAAGTTAAACAATTTGCCCAAGG - Intergenic
931166955 2:59758638-59758660 AAAGTGATACTGCTTGCCCAAGG + Intergenic
931455899 2:62409707-62409729 GAGGTGAAACAATTTGCCCAAGG + Intergenic
931746845 2:65298423-65298445 GAGTTGAAGTAGCTTGCCCAAGG + Intergenic
932702655 2:74002172-74002194 TAAGTGAAACAACTTACCCAAGG - Intronic
933781985 2:85808963-85808985 GAACTAAGACAACTTTCCCAAGG - Intergenic
933875692 2:86619437-86619459 GAGGTGAAGTAGCTTGCCCAAGG - Intronic
933939456 2:87233267-87233289 GAAAGGAAGGAGCTTGCCCAAGG - Intergenic
934093079 2:88571537-88571559 GAAGTTAAACAAATTGCCCAAGG + Intronic
934607452 2:95707788-95707810 GAAATGATATAGCTTGCTCAAGG - Intergenic
934967111 2:98732098-98732120 GAGGTGAAAGGGCTTGCCCAAGG + Intergenic
935130926 2:100260403-100260425 GAAGTGAAGCACCTTGTCCAAGG + Intergenic
935619783 2:105119039-105119061 GAACTGAGACAGATCCCCCAGGG - Intergenic
935639881 2:105280598-105280620 GACCTGAACCAGCTGACCCAGGG - Exonic
936083146 2:109448893-109448915 GAGCTAAAACAGCTTTGCCAAGG - Intronic
936353679 2:111732506-111732528 GAAAGGAAGGAGCTTGCCCAAGG + Intergenic
936540852 2:113349973-113349995 GAAATGATATAGCTTGCTCAAGG - Intergenic
936550613 2:113436027-113436049 GAACTGAACCACCATGCCTAAGG + Intergenic
936594668 2:113836434-113836456 GCAATGAAATAACTTGCCCAAGG - Intergenic
937161347 2:119765077-119765099 GAAATGAGACACTTTGCCCAAGG - Intronic
937964564 2:127492901-127492923 GAAGTTAAATAGCTTACCCAAGG + Intronic
938202930 2:129391447-129391469 GAAATGAAAGAGCTTCACCATGG + Intergenic
938271133 2:129972786-129972808 GAACTGAAAAACCTTTCTCAGGG + Intergenic
938371407 2:130770806-130770828 GAACGGAATCTGCTTGGCCAAGG - Intergenic
938411275 2:131066745-131066767 GAAGTTAAACAACTTTCCCAGGG + Intronic
938450786 2:131417824-131417846 GAAGGGAGGCAGCTTGCCCAAGG + Intergenic
939243075 2:139587340-139587362 GAACTGAAACAGATTCTCTATGG - Intergenic
940833766 2:158497631-158497653 GAAGTGAAATAACTTGCCTAAGG - Intronic
941962532 2:171268220-171268242 GAATTGAGACAGAGTGCCCAGGG - Intergenic
942123508 2:172801628-172801650 GATATTCAACAGCTTGCCCAAGG + Intronic
942128315 2:172849753-172849775 AAAATGAAGCAACTTGCCCAAGG - Intronic
942149436 2:173060328-173060350 GAAATGAAATATCTTGCCCGAGG + Intergenic
944669722 2:201984833-201984855 GATCTGAAATAGCTTGTCCAAGG - Intergenic
944946404 2:204691523-204691545 GAGATGAAGAAGCTTGCCCAAGG - Intronic
945028832 2:205644577-205644599 GAAGTGACAAAACTTGCCCAAGG - Intergenic
945443889 2:209913023-209913045 GAAATTAAATAACTTGCCCAAGG - Intronic
946440220 2:219688710-219688732 GAGCTTAAGCAACTTGCCCAAGG - Intergenic
946960494 2:224979870-224979892 GATGTTAAACAGCATGCCCAAGG + Intronic
947082437 2:226413482-226413504 GAGGTTAAACAACTTGCCCAAGG + Intergenic
947308041 2:228768800-228768822 TAACTTAAGCCGCTTGCCCAAGG + Intergenic
947538755 2:230959554-230959576 GCAGAGAAGCAGCTTGCCCAAGG + Intronic
1169028571 20:2390468-2390490 GAAGTGAAATAACTTGCCAAAGG - Intronic
1169924964 20:10773552-10773574 AAACTGAAGTAGCTTGCCCAAGG - Intergenic
1170549169 20:17461449-17461471 GAAGTGAAACAACTTGCTCCAGG + Intronic
1170794138 20:19531971-19531993 GAAATTAAGCAACTTGCCCAAGG + Intronic
1170947341 20:20903090-20903112 GATGTGAAATAACTTGCCCAAGG - Intergenic
1171972012 20:31570515-31570537 GAATTGAGGCAGCTTGCCCATGG + Exonic
1172325683 20:34032700-34032722 GAACTGAAATAATTTGCCCAGGG + Intronic
1172948195 20:38704475-38704497 GAGTTGAAATGGCTTGCCCAAGG - Intergenic
1173297712 20:41774050-41774072 GAAGTGAAGCAACTTCCCCAGGG + Intergenic
1173668795 20:44783112-44783134 GAACTGAAGCAGTTTGCCCAAGG + Intronic
1173917581 20:46719906-46719928 GAGAAGAAGCAGCTTGCCCAGGG + Intronic
1173949653 20:46979943-46979965 TAAGTGAAATAACTTGCCCAAGG + Intronic
1174209373 20:48865231-48865253 GACCTGAAACTGCTGGCCAAAGG - Intergenic
1174268959 20:49352918-49352940 GAGGTGAAATAGCTTGCTCAAGG + Intergenic
1175205453 20:57307881-57307903 GAACCTAAACAACTTGCCCAAGG + Intergenic
1175877077 20:62235421-62235443 GAGCAGAAGCAGCTTGCCCAGGG - Intronic
1178330511 21:31686468-31686490 GAATTTAAATAGCTTGCTCAAGG - Intronic
1178709815 21:34906551-34906573 GAAGTTAGACAACTTGCCCAAGG + Intronic
1178765701 21:35449082-35449104 GGAATGCAAGAGCTTGCCCAGGG + Intronic
1178796590 21:35750655-35750677 GAAAGGAAAAAGCTTGTCCATGG + Intronic
1179175916 21:39008135-39008157 GAAGTTAAGCATCTTGCCCAAGG + Intergenic
1179594450 21:42433023-42433045 GAACTGACACACCTTGTCCATGG + Intronic
1180463037 22:15584276-15584298 GAACTGAAAAACCTTTCTCAGGG - Intergenic
1181627268 22:24130428-24130450 GAAATTCAAGAGCTTGCCCAAGG - Intronic
1181921469 22:26323973-26323995 GAGATGAAACTGCTTGCCCAAGG + Intronic
1181949472 22:26543697-26543719 GAGATGAAGCAGCTTGCCCAAGG + Intronic
1181952550 22:26564891-26564913 GAGGTGAAGCAGTTTGCCCAGGG - Intronic
1181983812 22:26785126-26785148 GAGCTGCACCAACTTGCCCAAGG - Intergenic
1182118904 22:27774410-27774432 GAGGTGAAGCAACTTGCCCAGGG + Intronic
1182457036 22:30458377-30458399 ATACTGAAGCAGCTTGTCCAAGG - Intronic
1182747022 22:32613988-32614010 GAAGTGAAGCAACTTGCCCAAGG - Intronic
1183236658 22:36623918-36623940 GAAGTCAAGCAACTTGCCCAAGG - Intronic
1183373732 22:37450153-37450175 GAGGGGAAGCAGCTTGCCCATGG - Intergenic
1183600041 22:38834736-38834758 GGAGTTAAGCAGCTTGCCCAAGG - Intronic
1183734079 22:39634158-39634180 GAACTGAAACTGCTTGCCGTAGG - Intronic
1183795350 22:40112517-40112539 GAACTAAAACAGGATGCCCCTGG + Intronic
1184001382 22:41676421-41676443 GAAGTTAAACACCTTGCTCAAGG - Intronic
949698222 3:6724145-6724167 GATGTTAAATAGCTTGCCCAAGG - Intergenic
949843953 3:8351763-8351785 GAAGGGAAGAAGCTTGCCCAAGG - Intergenic
949918011 3:8979996-8980018 GAGGCTAAACAGCTTGCCCAAGG - Intergenic
949941890 3:9161474-9161496 GAAGTGAAACAACTTGCCCAAGG + Intronic
950116164 3:10451358-10451380 AAACTGAAGGAACTTGCCCAGGG - Intronic
950184374 3:10936260-10936282 GAAGTGAAGCAACTTGCCCAAGG + Intronic
950222269 3:11205438-11205460 GAAGTTAAAAAACTTGCCCAAGG - Intronic
950316855 3:12009501-12009523 GAAATGGAACATTTTGCCCAAGG + Intronic
950358138 3:12428979-12429001 GATCTTAATCAGTTTGCCCAAGG + Intronic
950793046 3:15488453-15488475 GAACAGAAACTGGTAGCCCAAGG - Intronic
951483133 3:23182956-23182978 GAAGTGAAGTGGCTTGCCCAAGG - Intergenic
951895347 3:27604772-27604794 GAGCTTTAACAGCTTGCCCAAGG - Intergenic
952625201 3:35394591-35394613 GAAATGAATCAAATTGCCCATGG + Intergenic
953381473 3:42475970-42475992 GAAGTTAAACACCTTGCCCAAGG + Intergenic
953470729 3:43163845-43163867 GAGCTTAAATAACTTGCCCAAGG + Intergenic
954624941 3:52017257-52017279 CAACTGAAGCAGCTTGCCTTTGG + Intergenic
954913639 3:54130635-54130657 GAACTGAAGCAGCCTCCCCAAGG + Intronic
955052640 3:55427425-55427447 GAATGAAAACAACTTGCCCAAGG - Intergenic
955350247 3:58188342-58188364 GAAGTTAAACAACTTGCCCGAGG - Intergenic
955399946 3:58584531-58584553 GAGCTTAAGCACCTTGCCCATGG - Intronic
955777196 3:62446513-62446535 GAGATGAAGCAACTTGCCCAAGG - Intronic
955875011 3:63479795-63479817 GAAATTAAGCAGCTTTCCCAAGG + Intronic
956275184 3:67491929-67491951 GAAGTTAAATAGCATGCCCAAGG + Intronic
956507103 3:69953463-69953485 GAAGAGGAACAGCTTGACCAAGG - Intronic
956727328 3:72167210-72167232 GAGGTTAAACTGCTTGCCCAAGG + Intergenic
956841629 3:73145400-73145422 GAGCTTAAAGAGCTTGTCCAAGG - Intergenic
959362569 3:105412014-105412036 GAACTGAAACAGGTTGCTGAAGG + Intronic
959859713 3:111203627-111203649 GAACTGCAACCGCTTGCAAAAGG + Intronic
960883796 3:122373782-122373804 GAAGTGAAACGGCTTGCAGAAGG + Intronic
961771387 3:129252666-129252688 GGACTGAAAGAGCTTGGTCATGG - Exonic
961785724 3:129345423-129345445 GCACTGATACACCTGGCCCAGGG - Intergenic
962066979 3:131991832-131991854 GAGCTGAAGCAGCTTGGACATGG - Intronic
962090035 3:132233672-132233694 GAAGTTAAATAACTTGCCCAAGG + Intronic
962167055 3:133060311-133060333 GAAGGGAAGTAGCTTGCCCAAGG + Intronic
962748752 3:138417429-138417451 GAATTGGAATAACTTGCCCAAGG - Intergenic
962915196 3:139894870-139894892 GAAACTAAACAACTTGCCCAAGG - Intergenic
963713384 3:148773960-148773982 GAAGTGAAACCACTTGCTCAAGG + Intergenic
963861533 3:150315363-150315385 GAAGTTAAGGAGCTTGCCCATGG - Intergenic
964106601 3:153046898-153046920 GAACTGGACCAGACTGCCCAAGG + Intergenic
964489993 3:157226093-157226115 GAACTAAAAAAGCTTGCCTGAGG + Intergenic
964565836 3:158051505-158051527 GCACTCCAACACCTTGCCCAAGG - Intergenic
965413745 3:168366239-168366261 GAAATTAAGCAGCTTGCTCAAGG + Intergenic
966674538 3:182571305-182571327 GAACTGAATTAGCTTGGCCAAGG - Intergenic
967053036 3:185802372-185802394 GAAAAGAAGCAGTTTGCCCAAGG + Intronic
967109198 3:186278482-186278504 GAAATGAAGGAACTTGCCCAAGG - Intronic
967823406 3:193859270-193859292 GAACTGAGGCAGTTTGCCCAGGG + Intergenic
967936121 3:194729120-194729142 GTGGTGGAACAGCTTGCCCAAGG + Intergenic
967990406 3:195126115-195126137 AAACTGCACCAGCTTGCCCAAGG - Intronic
969235185 4:5860521-5860543 GAGGTGAAGCAACTTGCCCAAGG - Intronic
971068454 4:23062219-23062241 GAAATTAAATAACTTGCCCAAGG - Intergenic
971155414 4:24076272-24076294 TAGATGAAGCAGCTTGCCCAAGG + Intergenic
971795980 4:31229070-31229092 GAAGTGATATAACTTGCCCATGG - Intergenic
972166064 4:36285722-36285744 GAAATGAAGCAAGTTGCCCAGGG - Intronic
972390512 4:38608704-38608726 GAGGTGAAATAGCTTGTCCAAGG - Intergenic
972443330 4:39118272-39118294 GAAGTTAAACAGCTAACCCAAGG + Intronic
972794666 4:42403403-42403425 GGAATGAAGCAACTTGCCCAAGG + Intergenic
975822487 4:78286105-78286127 GAGATTAAACAACTTGCCCATGG - Intronic
976138314 4:81962411-81962433 GAAATTAAATAACTTGCCCAAGG - Intronic
976348876 4:84037551-84037573 GAAACTAAACAACTTGCCCAAGG - Intergenic
976662804 4:87557595-87557617 TATCTGACAAAGCTTGCCCAGGG - Intergenic
976775573 4:88702367-88702389 GAAGTTAAATAACTTGCCCAAGG + Intronic
976883516 4:89959921-89959943 GAACAGATACATCTTGGCCAAGG + Intergenic
976987145 4:91315836-91315858 GAACTCAGATAACTTGCCCAAGG - Intronic
978453164 4:108859244-108859266 GAAGTGAAATAACTTGCCCTAGG + Intronic
978640654 4:110867447-110867469 GAAGTGAAAGAACTTGCCCTAGG + Intergenic
981431517 4:144666825-144666847 GAGGTTAAACAACTTGCCCAAGG - Intronic
981555176 4:145985262-145985284 AAACTGAAACGCCTTGCCCTTGG - Intergenic
981714921 4:147743430-147743452 GAAGTTAAACAACTTGCCCAAGG - Intronic
983236344 4:165184662-165184684 GAACTTAAACATTTTCCCCAGGG + Intronic
984161435 4:176257001-176257023 GAACTGAGTCAGCTAGCTCAGGG - Intronic
984368412 4:178828749-178828771 GAACTGACAGAGCTTGCTCATGG + Intergenic
985031264 4:185792911-185792933 GAAGTTAAACAACTTGCACAGGG - Intronic
985857002 5:2436219-2436241 AAACTGCAACAGCTTCCCCATGG + Intergenic
987250384 5:16094977-16094999 GAAGTTAAACAACGTGCCCAAGG + Intronic
987329514 5:16843466-16843488 GAGCTTAAAAATCTTGCCCAGGG + Intronic
989094593 5:37770102-37770124 GCAGTGGAACAACTTGCCCAAGG - Intergenic
989443668 5:41503479-41503501 GTACTGAAACAGATGGCCCATGG - Intronic
989770724 5:45141592-45141614 GAAATGAAACAACATGCCTAAGG - Intergenic
990707939 5:58551079-58551101 GAACTGAAATACTTTCCCCAGGG + Intronic
990737153 5:58876931-58876953 GAAGTCAAATAGCTTTCCCACGG - Intergenic
990908871 5:60833710-60833732 GAAGTGAAGAACCTTGCCCAAGG - Intronic
991492703 5:67198392-67198414 GAAGTGAAATGACTTGCCCAAGG - Intergenic
991664303 5:68982450-68982472 GAAATTAAATAACTTGCCCAAGG + Intergenic
992014593 5:72563045-72563067 GAGCTCAAAGTGCTTGCCCAAGG - Intergenic
992193570 5:74317521-74317543 GAGGGCAAACAGCTTGCCCAAGG + Intergenic
993942235 5:94073347-94073369 GAAGTTAAGCAACTTGCCCATGG + Intronic
994103219 5:95916611-95916633 CCACTGAAACTGCTTCCCCAAGG - Intronic
994140924 5:96340266-96340288 GAAATGAAACAGTTTGCCAGAGG - Intergenic
994157263 5:96517998-96518020 GAAGTTAATCACCTTGCCCAGGG + Intergenic
994781531 5:104095698-104095720 GACCTGAAGCAGCTGGCACAGGG + Intergenic
995033385 5:107505919-107505941 TAACTGAAGTAGCTTGCCCAAGG + Intronic
996395929 5:123014086-123014108 GAAGTGAAATAGCTTGACCAAGG + Intronic
996962947 5:129272819-129272841 GACCTAAAACAGCATGCCAAAGG + Intergenic
997202457 5:132019676-132019698 GAGCTGACATAGCTTGCCCAAGG + Intergenic
997309436 5:132867233-132867255 GAACTGAAATGACTGGCCCAAGG + Intronic
997645703 5:135480458-135480480 GAGATAAAGCAGCTTGCCCAGGG + Intergenic
997883214 5:137609121-137609143 GAGGTTAAACAGCTTGCACAGGG - Intergenic
998443755 5:142182738-142182760 GAAGTGAAATGACTTGCCCAAGG - Intergenic
998930493 5:147176026-147176048 GAAGTTAAACAACCTGCCCAAGG - Intergenic
998965531 5:147536069-147536091 GACTTGAAACAACTTGCCTAAGG + Intergenic
999010524 5:148033681-148033703 GAATTTAAGCAACTTGCCCACGG - Intronic
999086611 5:148897674-148897696 AAAGTGAAAAAACTTGCCCAAGG + Intergenic
999101004 5:149026378-149026400 GAAATTAAATAGCTTGCCCAAGG + Intronic
999480899 5:151947367-151947389 GATCAGAAACACCTTGTCCAAGG + Intergenic
999630803 5:153569347-153569369 GATCTGAGACTGCTTACCCATGG - Intronic
999720007 5:154392498-154392520 GAGGTGAAACAACTGGCCCAGGG - Intronic
1000179426 5:158793629-158793651 GAGGTTAAAAAGCTTGCCCAAGG - Intronic
1000273510 5:159710405-159710427 GAAGAGGAACAGCTTGCTCATGG + Intergenic
1000298886 5:159937339-159937361 GAGTTTAAACAACTTGCCCAGGG + Intronic
1000451419 5:161392582-161392604 GAAGTTAAACAACATGCCCAAGG - Intronic
1001152636 5:169245563-169245585 GAAATGACACAGATTGCACATGG + Intronic
1001238876 5:170052852-170052874 GAATTTAAGCAGCTTGCACAAGG + Intronic
1001545171 5:172566476-172566498 GAGCCCAAGCAGCTTGCCCAAGG - Intergenic
1001567910 5:172712534-172712556 GAGCTTAAGCAACTTGCCCAAGG + Intergenic
1001953185 5:175830346-175830368 GACATGAAGCAACTTGCCCAGGG + Intronic
1003333826 6:5152193-5152215 GAAGCTAAGCAGCTTGCCCATGG + Intronic
1003370547 6:5521731-5521753 ACACTGAAACAGGTTACCCAGGG - Intronic
1004251882 6:14029525-14029547 TAAGTAAAACAGCTTACCCAAGG - Intergenic
1004691294 6:17994409-17994431 CAATTTAAGCAGCTTGCCCAAGG + Intergenic
1004705940 6:18123840-18123862 GAAATCAAATATCTTGCCCAGGG + Intergenic
1004733237 6:18379647-18379669 GAAGAAAAACACCTTGCCCAGGG - Intergenic
1004802422 6:19164317-19164339 GAAGTTAAATACCTTGCCCATGG - Intergenic
1006264589 6:32909083-32909105 AACTTGAAAGAGCTTGCCCAAGG - Intergenic
1006533149 6:34674582-34674604 GAATTGAAACAGATTGCCTCTGG + Intronic
1007117082 6:39350422-39350444 GAGATGAAGTAGCTTGCCCAGGG - Intronic
1007157477 6:39759487-39759509 GAACTGAAATAATTTGCCCAAGG - Intergenic
1007395751 6:41576777-41576799 GAACTGGAATAACTTGCCCAAGG + Intronic
1007695973 6:43734433-43734455 TAACTGAAGCACCTTGCCCGAGG - Intergenic
1007766458 6:44163195-44163217 GAGGTCAAACAACTTGCCCAAGG + Intronic
1007827086 6:44608605-44608627 GAAGTTAAGCAACTTGCCCAAGG - Intergenic
1007953795 6:45897580-45897602 GAAATGAAACAGCAGACCCAGGG - Intergenic
1008800396 6:55362169-55362191 GAGATTAAATAGCTTGCCCAGGG + Intronic
1008877497 6:56345571-56345593 GAAATGAAGCAGCTTTCCCAAGG + Intronic
1010509560 6:76701925-76701947 TAGCAGAAACAGCTTGCCCCTGG + Intergenic
1013034150 6:106363739-106363761 GAGGTGAAATAACTTGCCCAAGG - Intergenic
1015653912 6:135495824-135495846 GAAATTAAGTAGCTTGCCCAAGG - Intronic
1015681525 6:135813926-135813948 AAACTTAAATAGCTTGTCCAAGG - Intergenic
1018271244 6:162080242-162080264 GAATTGAAATTACTTGCCCAAGG - Intronic
1019058371 6:169238898-169238920 GACCTGAAGCACCTTGCCAACGG + Intronic
1019578065 7:1746992-1747014 GAACTGAACCTTCTTGCGCAGGG - Exonic
1019639630 7:2096561-2096583 GCACTGAAACAGCTCTCCAAGGG + Intronic
1020225792 7:6278933-6278955 GAGGTGAAGCAACTTGCCCAAGG - Intergenic
1021977160 7:26021781-26021803 GCAATGAACCAGCTTGCCAATGG + Intergenic
1022305051 7:29139238-29139260 GAAGTGAATTGGCTTGCCCAAGG - Intronic
1022459569 7:30592772-30592794 GATATCAAACAGCTTGTCCATGG - Intergenic
1022756524 7:33298284-33298306 GAACTTAAATAGCTTGCCCAAGG - Intronic
1023330635 7:39112555-39112577 TAACTGAAATAGCTTGCCAGTGG - Intronic
1023356893 7:39375982-39376004 GAATTTAAGTAGCTTGCCCAAGG - Intronic
1023468310 7:40484086-40484108 GAAATTAAGCAACTTGCCCATGG + Intronic
1023565254 7:41517823-41517845 GAAATTAAGCACCTTGCCCAAGG + Intergenic
1024189419 7:46990654-46990676 GAACTGAATAAGCTTTCCCAGGG + Intergenic
1027529864 7:79316879-79316901 GAAGTTAAATAACTTGCCCAGGG + Intronic
1028137226 7:87234758-87234780 TAACTGCAACTCCTTGCCCAGGG + Intergenic
1028903750 7:96130499-96130521 GAAGTGAAGTAACTTGCCCAAGG + Intronic
1029389842 7:100267786-100267808 GAAGTCAAGCAACTTGCCCAAGG + Intronic
1030009392 7:105151316-105151338 CAGCTTAAACAGCTTGCCCAGGG - Intronic
1030160723 7:106505783-106505805 GAGATAAAATAGCTTGCCCAAGG - Intergenic
1031067764 7:117124691-117124713 AAAGTTAAACAACTTGCCCAAGG - Intronic
1031244535 7:119292283-119292305 GTAGTGAAACAGTTAGCCCAGGG - Intergenic
1032738825 7:134718381-134718403 GAAGTTAAATAGCTTGCCCAAGG + Intergenic
1033356320 7:140602932-140602954 GGACTTAAACAACTTGCCTAAGG - Intronic
1034504492 7:151476498-151476520 GACCTAAAGCAGCTTGCCCAGGG - Intronic
1036166830 8:6443170-6443192 GAGGTCAAACAGCTTGTCCAAGG + Intronic
1036215898 8:6879548-6879570 GAATTGAAACAAATTGCCCAAGG + Intergenic
1036697141 8:10982943-10982965 GAAGTTAAATGGCTTGCCCAAGG - Intronic
1037459428 8:19094350-19094372 GAGCTGAAGCAACTTGCCCAAGG + Intergenic
1037714521 8:21385856-21385878 GCACTGAAACAACTTGCCGTTGG + Intergenic
1037972232 8:23180776-23180798 TAACAGTAACAGCTTGCCTATGG - Intergenic
1039180068 8:34857163-34857185 GAAATTAAATGGCTTGCCCAAGG + Intergenic
1039236108 8:35504252-35504274 GAGCCCAAACAGCTTGCCTAAGG - Intronic
1039578361 8:38643747-38643769 GAATAGAAACACCTTCCCCAGGG - Intergenic
1041441070 8:57897623-57897645 GAACTGAAAAAGCAGACCCAGGG + Intergenic
1042210770 8:66378143-66378165 GAAGTGAAGCTGCTTGCCCAAGG + Intergenic
1042580795 8:70277088-70277110 AAAATTAAAGAGCTTGCCCATGG - Intronic
1042977741 8:74489118-74489140 AAACTGAAGCAACTTGGCCATGG + Intergenic
1043490725 8:80746514-80746536 AAACTTAAACATCTTGCCCAAGG - Intronic
1043531508 8:81156427-81156449 GAAGTGAAGCAACTTGCCCAAGG + Intergenic
1044631996 8:94289253-94289275 GCACTGCATCTGCTTGCCCAAGG - Intergenic
1045528350 8:102960712-102960734 GAAGTTAAATAACTTGCCCAAGG + Intronic
1045917230 8:107486682-107486704 GCAGTGAAGAAGCTTGCCCAAGG + Intronic
1046517712 8:115285024-115285046 GAACTCCAGCAGCTTTCCCAGGG - Intergenic
1046695537 8:117335273-117335295 GAGTTAAAGCAGCTTGCCCAAGG - Intergenic
1047314463 8:123719829-123719851 GACGTGAATCAGCTTGCCCAAGG - Intronic
1047777698 8:128087171-128087193 GAGGTGAAACTTCTTGCCCATGG + Intergenic
1048006759 8:130425867-130425889 GAACTGACCCAGCTTAGCCATGG + Intronic
1048212728 8:132468845-132468867 GAACTTAAGCAGCTGGCTCATGG - Intronic
1048349345 8:133603574-133603596 GAGCTGAAATAACTTGCCAAAGG - Intergenic
1049499063 8:142951780-142951802 GAAGTTAAATAGCTTTCCCAAGG - Intergenic
1049970841 9:820644-820666 GAAGTGAAAGAGCTTTTCCAAGG + Intergenic
1050110458 9:2210045-2210067 GAACTGAAGTCACTTGCCCAGGG + Intergenic
1050427880 9:5530626-5530648 GAAGTGATGCAACTTGCCCAAGG - Intronic
1050447860 9:5745423-5745445 GAAACGAGACAGCTTGGCCAAGG + Intronic
1050488652 9:6163603-6163625 GAACTTAAGTAACTTGCCCAAGG + Intergenic
1051768148 9:20546891-20546913 GAACTGCAACTGCTTGCAGAAGG - Intronic
1052930664 9:34052834-34052856 GAAGTGACACAGCTTGTACAGGG - Intergenic
1053293194 9:36895701-36895723 GAAGTGAAGTAACTTGCCCATGG + Intronic
1055532083 9:77194394-77194416 GAACAGAACTATCTTGCCCATGG - Intronic
1055535916 9:77244281-77244303 GAACTGAGACAGCGTTCCCTAGG + Intronic
1056255864 9:84799007-84799029 AAACTGAGGCAACTTGCCCAAGG + Intronic
1056646122 9:88413365-88413387 GAACAAAAACACCTTGGCCAGGG - Intronic
1057575259 9:96237379-96237401 GAGCTGCAACAGCTGGCCCATGG - Intronic
1057882751 9:98805692-98805714 GAAGTGAAGCAACTTGCCCAAGG - Intergenic
1057903921 9:98969844-98969866 GAAGTTAAATAACTTGCCCAAGG - Intronic
1058282045 9:103127847-103127869 CAACTGCAACAGGGTGCCCATGG + Intergenic
1058312750 9:103525846-103525868 GAGCTTAAGCAGCTTGCTCAAGG + Intergenic
1058979173 9:110153115-110153137 GAACTGGAAAAACTTGCTCAAGG + Intronic
1059201418 9:112420618-112420640 GAAGTGCAACAGCATGACCATGG - Intronic
1059344742 9:113620532-113620554 GAAGTGGAATAACTTGCCCAGGG + Intergenic
1059454524 9:114391148-114391170 GAGCCCAAGCAGCTTGCCCAAGG + Intronic
1059454697 9:114392468-114392490 GAGGTTAAGCAGCTTGCCCAAGG - Intronic
1059624115 9:116042629-116042651 GAGCAGAAGCAGCTTGCCAAAGG - Intergenic
1059976758 9:119725811-119725833 AAAATAAATCAGCTTGCCCACGG + Intergenic
1059980332 9:119764547-119764569 GAATTGAATGATCTTGCCCAAGG - Intergenic
1060067988 9:120521308-120521330 GAGCTCAAATATCTTGCCCAAGG + Intronic
1060291403 9:122306462-122306484 GAGGTGAAATAACTTGCCCAGGG + Intronic
1060440582 9:123635354-123635376 GAGGTGAAATAACTTGCCCAAGG + Intronic
1060688989 9:125639334-125639356 GAAGTTAAACAGCTTGCCTTAGG - Intronic
1061676254 9:132217482-132217504 GAAGTTAAGCAACTTGCCCAAGG - Intronic
1185634600 X:1542442-1542464 GAAGTGAAACAGCTGTCCCAAGG + Intergenic
1186915119 X:14210571-14210593 GAGCTTAAGTAGCTTGCCCAAGG + Intergenic
1187254372 X:17628755-17628777 GAGGTTAAACAACTTGCCCAAGG - Intronic
1188360032 X:29241863-29241885 GAACTGAAACTGCACTCCCAGGG + Intronic
1189094948 X:38128201-38128223 GAGCTGAGATAACTTGCCCAAGG + Exonic
1189196019 X:39153244-39153266 GAAGTGAAGCAACCTGCCCAAGG - Intergenic
1189747939 X:44189335-44189357 GAGCTTTAACAGATTGCCCAAGG + Intronic
1190881276 X:54494594-54494616 GAAGTTAAGCAACTTGCCCAAGG - Intronic
1190909195 X:54756689-54756711 GAACAGAAACAAATTGGCCAAGG - Intronic
1191733089 X:64358554-64358576 AAAGTTAAACAACTTGCCCAAGG + Intronic
1191885773 X:65886448-65886470 GAACTGAAATAGTTTGCCCAAGG - Intergenic
1192190299 X:68987183-68987205 GAAGTGCAATGGCTTGCCCATGG - Intergenic
1192239548 X:69318579-69318601 GAAAAGAAGCAACTTGCCCAAGG - Intergenic
1192266599 X:69543056-69543078 GAAAAGAAAGAACTTGCCCAAGG + Intergenic
1195305168 X:103574765-103574787 GAACTGAAGGACCTTACCCATGG + Intergenic
1195475826 X:105284207-105284229 GAAGTTACACAACTTGCCCAAGG + Intronic
1195761084 X:108247223-108247245 GAGATAAAGCAGCTTGCCCAAGG - Intronic
1196198277 X:112857860-112857882 GAACTGAAGTGACTTGCCCACGG - Intergenic
1197122921 X:122913622-122913644 GCACAAAGACAGCTTGCCCAAGG - Intergenic
1197170501 X:123428410-123428432 GAAGTTAAATGGCTTGCCCAAGG - Intronic
1197538705 X:127726484-127726506 GAAGTGAAAGTGCATGCCCATGG - Intergenic
1197882300 X:131179684-131179706 GAAATTATACAGCTTGCCTAAGG + Intergenic
1198153797 X:133937133-133937155 GAAATGAAATTGATTGCCCAAGG + Intronic
1198507583 X:137316801-137316823 GAAGTGAAGTAACTTGCCCAAGG + Intergenic
1198545597 X:137689473-137689495 GAAGTTAAGCAACTTGCCCATGG + Intergenic
1198763750 X:140060729-140060751 GAACTGAAACTGGATCCCCAAGG + Intergenic
1199412534 X:147541280-147541302 GGATTGAAGCAGCTTGCTCAAGG - Intergenic
1199424006 X:147680355-147680377 GAACTGAAACTCCTTACTCAGGG + Intergenic
1199575428 X:149309042-149309064 GGGCTTAAAGAGCTTGCCCAAGG - Intergenic
1200889927 Y:8312634-8312656 GAACTGAAATAGCAGGGCCAAGG - Intergenic