ID: 907132300

View in Genome Browser
Species Human (GRCh38)
Location 1:52107795-52107817
Sequence CTCAGCCTCCCGAGTAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907132290_907132300 26 Left 907132290 1:52107746-52107768 CCATAGCACACTACAGCCCAGAA No data
Right 907132300 1:52107795-52107817 CTCAGCCTCCCGAGTAATGGGGG No data
907132293_907132300 10 Left 907132293 1:52107762-52107784 CCCAGAACTGCTGGGTTCAAGCA No data
Right 907132300 1:52107795-52107817 CTCAGCCTCCCGAGTAATGGGGG No data
907132294_907132300 9 Left 907132294 1:52107763-52107785 CCAGAACTGCTGGGTTCAAGCAA No data
Right 907132300 1:52107795-52107817 CTCAGCCTCCCGAGTAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907132300 Original CRISPR CTCAGCCTCCCGAGTAATGG GGG Intergenic
No off target data available for this crispr