ID: 907133067

View in Genome Browser
Species Human (GRCh38)
Location 1:52114210-52114232
Sequence AATCTTGGACTTCAATTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907133063_907133067 16 Left 907133063 1:52114171-52114193 CCTGAAGGTTCAGAGTTGAGACA No data
Right 907133067 1:52114210-52114232 AATCTTGGACTTCAATTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907133067 Original CRISPR AATCTTGGACTTCAATTGTT GGG Intergenic
No off target data available for this crispr