ID: 907137760

View in Genome Browser
Species Human (GRCh38)
Location 1:52155648-52155670
Sequence GCAAGCAATCCCTATGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907137760 Original CRISPR GCAAGCAATCCCTATGCTGT TGG (reversed) Intronic
900863491 1:5250444-5250466 CCAAGCAGCCCCTATGCTCTGGG - Intergenic
903176357 1:21583801-21583823 AAAAGAAATCCCTGTGCTGTGGG - Intergenic
906359087 1:45137306-45137328 GCCTGCAATCCCAATGCTTTGGG - Intronic
906448772 1:45925751-45925773 GGAAGAAATTCCTATGCAGTAGG - Intronic
907137760 1:52155648-52155670 GCAAGCAATCCCTATGCTGTTGG - Intronic
911611267 1:99961244-99961266 ACAAGTAATCCCAGTGCTGTGGG + Intergenic
914335112 1:146707702-146707724 GCAAGCAATCCCAGCGCTTTGGG - Intergenic
916980848 1:170135417-170135439 GCAAACACTCCCTATGCAGTTGG + Intergenic
922409528 1:225358122-225358144 GCAAGAAAACCCCATGGTGTTGG - Intronic
922997184 1:229973401-229973423 CCAGCCAATCCCTATGCAGTGGG - Intergenic
922997239 1:229973729-229973751 GCAATCTTTCCCGATGCTGTAGG + Intergenic
1070358253 10:75661472-75661494 CCAAGCAATGCCAATGCTGCTGG + Intronic
1075505698 10:123019802-123019824 ACAAGGGATCCTTATGCTGTTGG - Intronic
1081034511 11:38125606-38125628 GCAAACAATCTCTATGCATTTGG - Intergenic
1081633746 11:44706960-44706982 GCCTGTAATCCCTATGCTTTGGG + Intergenic
1083843546 11:65317654-65317676 GCAAGCACTCCCTCTGCTTGAGG - Intronic
1085005474 11:73084651-73084673 GCCAGTAATCCCAATGCTTTGGG - Intronic
1097572658 12:61354618-61354640 TCAAGCAATCCCTCTGCCTTGGG - Intergenic
1099923696 12:88990948-88990970 GGAACCAAGCACTATGCTGTGGG - Intergenic
1103575243 12:121872488-121872510 GCCTGCAATCCCAATGCTTTGGG - Intergenic
1106853917 13:33827162-33827184 GCTAGCAATCCCAGTGCTTTGGG + Intronic
1111197482 13:84894234-84894256 GCAAGCAATGGCAATGCAGTGGG - Intergenic
1111986060 13:95068170-95068192 TCAGGCAGTCCCTTTGCTGTTGG - Intronic
1118970607 14:70634203-70634225 GAAACCAATCACTATGGTGTAGG + Intergenic
1123850422 15:24350495-24350517 GCTTGCAATTCCTATGCTTTGGG - Intergenic
1123871314 15:24577069-24577091 GCTTGCAATTCCTATGCTTTGGG - Intergenic
1125868818 15:43078706-43078728 GCCTGCAATCCCAATGCTTTGGG + Intronic
1134039847 16:11060155-11060177 GCCAGGAATCCCTGTGCTGGTGG + Intronic
1138362581 16:56444031-56444053 GCATGTAATCCCAATGCTTTGGG + Intronic
1140395072 16:74619441-74619463 GCCTGCAATCCCAATGCTTTGGG + Intergenic
1140493552 16:75362413-75362435 GCAAGGCATCCCTATGTTCTGGG + Intronic
1142834253 17:2573130-2573152 TCAAGCAATCCACTTGCTGTGGG - Intergenic
1142918489 17:3163311-3163333 GCAAGAAATCCCAGTACTGTTGG - Intergenic
1144933381 17:18878272-18878294 GCCTGCAATCCCAATGCTTTGGG + Intronic
1146525601 17:33564635-33564657 GCAAGCCACCCCTAGCCTGTTGG + Intronic
1149573729 17:57696478-57696500 GCTAGCAATCCCAATGTTTTGGG + Intergenic
1150972120 17:70040469-70040491 CCAGGCAATGCCAATGCTGTTGG - Intergenic
1153522854 18:5968436-5968458 GCAAGTAATCCCAGTGCTTTGGG + Intronic
1155558676 18:27051151-27051173 GCTTGTAATCCCTATGCTTTGGG + Intronic
1161224115 19:3134995-3135017 GCATGTAATCCCTATACTTTGGG - Intergenic
1163793858 19:19324309-19324331 GCAAGGAGTGCCTAAGCTGTCGG + Intronic
1166215741 19:41333616-41333638 GCCAGTAATCCCAATGCTTTGGG - Intronic
1166704275 19:44900120-44900142 GCAAGCACTCCCTACGGTGGAGG + Intronic
1167673790 19:50872234-50872256 GCCAGCAATCCCAGTGCTTTGGG - Intronic
925593534 2:5533305-5533327 GCAAGCAGCCCGTGTGCTGTGGG + Intergenic
926930974 2:18040502-18040524 GCAAGCAATCCCCACACTTTGGG - Intronic
927856733 2:26532442-26532464 GCCAGCAAGCCCCATGCTGGGGG + Intronic
928039686 2:27862207-27862229 GCATGCAATCCCTACACTTTGGG - Intronic
928592107 2:32827679-32827701 GCAAGAAATCCCTATGCTTTGGG - Intergenic
929219907 2:39452634-39452656 GCCTGTAATCCCTATGCTTTCGG + Intergenic
930429882 2:51262306-51262328 GCAAGCAAAGCCTCTGATGTTGG - Intergenic
930782429 2:55235931-55235953 GCCTGTAATCCCTATGCTTTGGG + Intergenic
934734267 2:96680981-96681003 GCCTGCAATCCCAATGCTTTGGG - Intergenic
935649969 2:105373786-105373808 GCAAGGGGCCCCTATGCTGTGGG - Intronic
935675685 2:105593391-105593413 GGAAGCAATCCCTATGTTGGTGG + Intergenic
938389839 2:130896434-130896456 GCAGGCAGTCCACATGCTGTGGG - Intronic
942232609 2:173874095-173874117 GCACGGTCTCCCTATGCTGTGGG - Intergenic
1170123989 20:12942170-12942192 GCCAGCAAGGCCTATGCTCTTGG - Intergenic
1171506723 20:25642348-25642370 GCATGTAATCCCAATGCTTTGGG - Intergenic
1172063262 20:32201685-32201707 GCCAGCAATCCCAATACTTTGGG + Intronic
1173643493 20:44619379-44619401 GCCAGAGATCCCAATGCTGTGGG - Intronic
1175185268 20:57175724-57175746 AAAAGCAATCCCTCTGTTGTGGG - Intronic
1178055783 21:28797008-28797030 CCAAGTATTCCCTAGGCTGTTGG + Intergenic
1179214074 21:39350708-39350730 GCAAGCGAACTCTATGCTTTTGG + Intergenic
1181269527 22:21651091-21651113 GCAACCAAAGCCCATGCTGTGGG + Intergenic
1184514088 22:44950454-44950476 GCTAGGAATCCCTTTACTGTTGG - Intronic
950994368 3:17479948-17479970 CCAAGGAATCCCTGTGCTCTTGG + Intronic
952276294 3:31880387-31880409 GCAAGGAATCCCCCTGCTCTGGG + Intronic
956170229 3:66427563-66427585 GCAAGCAGTCCTTCTACTGTTGG - Intronic
960797088 3:121498954-121498976 GCCTGTAATCCCAATGCTGTAGG + Intronic
962828742 3:139121436-139121458 GCAAGTAAGCCCTATGCTTAGGG + Intronic
965912267 3:173793408-173793430 GAAAGCAAGACCTATGCTGGAGG + Intronic
973945695 4:55952660-55952682 GTAAGCACACCCTATGATGTTGG - Intronic
974084164 4:57241898-57241920 GAAAGCAATCTCTGTGCTTTTGG + Intergenic
976206201 4:82625717-82625739 GCTGGCAACCCCTGTGCTGTGGG - Intergenic
978054070 4:104240992-104241014 TCATGGAATCCCTATGATGTAGG - Intergenic
978641981 4:110881599-110881621 GCATGTAATCCCAATGCTGTGGG - Intergenic
979827002 4:125250093-125250115 GCATGTAATCCCAATGCTTTGGG + Intergenic
989700966 5:44264463-44264485 CCAAGCAATACCAATGCTGCTGG - Intergenic
992668120 5:79031532-79031554 GCAGGAGATGCCTATGCTGTTGG + Intronic
997622788 5:135309787-135309809 GCAGGCAAAGCCTTTGCTGTGGG + Intronic
998724889 5:145000492-145000514 CCCAGCAATCCCTCTACTGTTGG - Intergenic
1001935331 5:175699540-175699562 GCACCCAGTCCCTCTGCTGTCGG + Intergenic
1002114917 5:176952670-176952692 GCCTGCAATCCCAATGCTTTGGG + Intronic
1003157526 6:3608949-3608971 GCTAGACATCCCTATACTGTCGG + Intergenic
1011951792 6:92975863-92975885 GCCTGCAATCCCTGTGCTTTGGG - Intergenic
1013355733 6:109344374-109344396 CCCAGCAATCCCTGTGGTGTGGG - Intergenic
1013680673 6:112521976-112521998 TCAGGCAATCCTTATGCTGATGG + Intergenic
1014832015 6:126113918-126113940 GCAGGCAATGTCAATGCTGTTGG + Intergenic
1016171021 6:141017072-141017094 GCCTGCAATCCCAATGCTTTGGG - Intergenic
1018259469 6:161955172-161955194 GCAAGATAACCCTTTGCTGTGGG + Intronic
1019972462 7:4552055-4552077 GAAAGCAATCCTTAGGCTGGGGG - Intergenic
1020663559 7:11010912-11010934 GCCTGCAATCCCAATGCTTTGGG - Intronic
1020800139 7:12722918-12722940 GCAAGTAATTCTTATGCAGTTGG - Intergenic
1020849887 7:13339534-13339556 GCAAGCAATCTCAATGTGGTAGG + Intergenic
1021556594 7:21925628-21925650 GCCTGCAATCCCAGTGCTGTGGG + Intronic
1024846720 7:53653089-53653111 GAAAGGATTCCCTATGGTGTTGG + Intergenic
1024966767 7:55030030-55030052 GAAAGCTATCCCAATCCTGTGGG - Intronic
1026158800 7:67851068-67851090 TCAAGCCATCCATATGCTCTGGG - Intergenic
1026620851 7:71948780-71948802 GCATGCAATCCCAATGTTTTTGG + Intronic
1027468460 7:78544030-78544052 GGAAACAATCTCTATGCTTTGGG + Intronic
1029141546 7:98414343-98414365 GCCTGCAATCCCTATGCTTTGGG + Intergenic
1029480774 7:100811608-100811630 GCCTGCAATCCCAGTGCTGTGGG + Intronic
1030234398 7:107242752-107242774 GCAAGGAGTGTCTATGCTGTGGG - Intronic
1035053367 7:156017531-156017553 ACAAGCAATGCCTATAATGTGGG + Intergenic
1036117200 8:5971409-5971431 GCCTGGAATCCCTATGCTTTGGG + Intergenic
1042887036 8:73563760-73563782 GCATGTAATCCCAATGCTTTGGG - Intronic
1044731744 8:95234083-95234105 CCAAGCAATCCCTGTGTTTTTGG + Intergenic
1045036509 8:98180407-98180429 GCAACCTGTCCCTAGGCTGTTGG + Intergenic
1048055057 8:130855359-130855381 CCAGACAATCCATATGCTGTGGG - Intronic
1048060538 8:130915399-130915421 GACAGGAATCCCAATGCTGTAGG + Intronic
1048158230 8:131983693-131983715 GGGAACAATCCCTGTGCTGTGGG - Intronic
1048807215 8:138251967-138251989 GGAAGCAAAGCCTATGGTGTTGG - Intronic
1049533060 8:143166014-143166036 GCTGGCAAGCCCTCTGCTGTAGG - Intergenic
1050444874 9:5710229-5710251 TCAAGCAATCTCTATGTTGATGG - Intronic
1056525728 9:87441330-87441352 GCCTGCAATCCCAATGCTTTGGG + Intergenic
1058128439 9:101223051-101223073 ACAGGTAATCCCTGTGCTGTGGG + Intronic
1058841943 9:108918369-108918391 GCAAGCAGATCCTCTGCTGTAGG + Intronic
1062193038 9:135257389-135257411 GCCTGCCCTCCCTATGCTGTGGG - Intergenic
1188265420 X:28067353-28067375 GCAATCATTCCCCCTGCTGTTGG - Intergenic
1189364264 X:40376315-40376337 GCAAGCAAACCCCAGGTTGTAGG + Intergenic
1189459218 X:41223941-41223963 GCCTGTAATCCCTATGCTTTGGG + Intronic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1196803868 X:119567705-119567727 TCAAGCAATCCTTCTGCTGCAGG + Intergenic
1197127327 X:122962419-122962441 ACAAGCAATCACTATGATATGGG + Intergenic
1198058774 X:133022392-133022414 GTATGCAATCCCTGTGCTTTGGG + Intergenic
1202273640 Y:23094517-23094539 GCCTGCAATCCCAATGCTTTAGG + Intergenic
1202292386 Y:23326164-23326186 GCCTGCAATCCCAATGCTTTAGG - Intergenic
1202426637 Y:24728262-24728284 GCCTGCAATCCCAATGCTTTAGG + Intergenic
1202444152 Y:24941824-24941846 GCCTGCAATCCCAATGCTTTAGG - Intergenic